1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katena32 [7]
2 years ago
10

175g plus 0.4kg equal in grams

Mathematics
1 answer:
JulijaS [17]2 years ago
8 0

Answer:

575g

Step-by-step explanation:

Since we need the ans in grams first ensure that both values are in the same unit.

So convert 0.4 kg into grams by multiplying it with 1000grams.

This gives us 400g

175+400=575g

You might be interested in
Find the value of x. (x+35)° 4x°​
LUCKY_DIMON [66]

Answer:

x = 29

Step-by-step explanation:

Added together equals to 180 degrees. Write out the equation:

x + 35 + 4x = 180

5x + 35 = 180 (Add the x together)

5x = 145 (Minus both sides by 35)

x = 29

3 0
3 years ago
Find the missing value
yawa3891 [41]
It is easier to write the equivalent ratios first, then use that information to find the missing values.

3. ratio: cars/trucks = 3/5, or trucks/cars = 5/3. Missing value: 6/3*5 = 10.

4. ratio: TVs/Computers = 2/7, or Computers/TVs = 7/2. Missing value: 21/7*2 = 6.
8 0
3 years ago
2. Twenty teenagers were asked the question “How many hours of sleep do get a night?”. The sample had a mean of 6.5 hours and a
hram777 [196]
You can get about eight or night hours at night it depends when you go to bed
5 0
4 years ago
Given the pre-image ABCD and the image after a dilation, A'B'C'D', what is true about the polygons? Check all that apply.
miskamm [114]

Answer:the length AB is 2

The length A’B’ is 3

The scale factor is 3/2

Step-by-step explanation:

5 0
3 years ago
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
Other questions:
  • A charity received a donation of 25.6 million. If this represents 54% of the charity‘s donated funds, what is the total amount o
    14·1 answer
  • Ms. Bertini's secret number is less than 90, but greater than 40. It is a multiple of 6 and a multiple of 5. What is the secret
    14·2 answers
  • Subtract.
    10·1 answer
  • 1. What is the slope of the line passing through the points (2,7) and (-1,3)?
    5·1 answer
  • Jskawlowlekdkckfkdkdkdkkfkfkfkfkfkr
    5·1 answer
  • Which of the following data sets has the mean, median, and mode as the same number?
    7·1 answer
  • Write a quadratic function in vertex form whose graph has the vertex ( -5. - 1) and passes through the point (-2.2).
    11·1 answer
  • QUICK what’s the answer whoever gives correct a answer gets brainliest
    15·1 answer
  • If 9% of a number is 75, find 3% of that number.
    5·2 answers
  • Solve for k<br> 18 = -k + 3
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!