1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaK [193]
2 years ago
12

Make 2 Punnett squares using these crosses. AA x aa and Aa x aa

Biology
1 answer:
fgiga [73]2 years ago
8 0

Answer:

Attached is an image of the two Punnett squares. When making Punnett squares, each parent's alleles are crossed. This results in 4 possible genotypes of the children.

You might be interested in
25.
laila [671]
The answer would be C as it can be directly tested experimentally and observed that bacteria adapted to become drug resistant and the natural selection of drug resistant bacteria to survive and continue proliferating, thus being direct evidence of evolution
4 0
3 years ago
Steroid hormones and thyroid hormones ________ pass across the plasma membrane; they cause the target cells to ________ that pro
tekilochka [14]

Answer:

can ,synthesize specific proteins

Explanation:

Hormones are chemical signals secreted by animals and plant that are capable of regulating body activities and maintain homeostasis.

They are transported in the circulatory system of the body

The action of hormones can be seen after the hormone has bound to its specific receptor found inside the cell.

For instance, steroid hormone and the thyroid hormones can pass through the plasma membrane to their receptors inside the cells.

When they bind with their receptors, the target cells will synthesize specific proteins that produce the characteristic effect of the hormone.

6 0
3 years ago
What is the most important function of sweating
Kobotan [32]
A. To remove excess Heat from the body
6 0
3 years ago
Read 2 more answers
The smallest units considered to be alive are organelles
aivan3 [116]
This is true. Hope this helps.
7 0
4 years ago
Read 2 more answers
If an organism has 32 chromosomes describe where/how they got that number of chromosomes.
kvv77 [185]

Answer: They got 16chromosomes from each parent

Explanation:

5 0
3 years ago
Other questions:
  • Because of physiologic changes during pregnancy, maternal red blood cell volume and iron storage in the fetus results in an incr
    8·1 answer
  • What are the four main factors that influence blood pressure?
    11·1 answer
  • The sizes, shapes, and arrangements of mineral grains in an igneous rock are known as ________.
    11·1 answer
  • In Mendel's work with peas, an F1 hybrid (smooth yellow) was crossed to the recessive (wrinkled green) parent type. In terms of
    11·1 answer
  • How do scientific models provide a practical solution for some types of research? Check all that apply.
    11·1 answer
  • Animals have life cycles that also help them adapt. How does a frog's life cycle help the frog's species?
    6·1 answer
  • In the past, some scientists accepted the theory of spontaneous generation. This theory states that organisms can arise from non
    10·1 answer
  • Saturated fats ______________________.
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How do you think the sequence of amino acids in an enzyme relates to its ability to bind to a specific target molecule?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!