1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DaniilM [7]
3 years ago
11

When the M phase begins during the cell cycle, it starts with _____. metaphase anaphase telophase prophase

Biology
2 answers:
Gelneren [198K]3 years ago
7 0
When the M phase begins during the cell cycle, it starts with prophase
Nastasia [14]3 years ago
7 0

Answer: The correct answer for the blank is-

Prophase.

M phase (mitotic phase) is the second phase of cell cycle (the first being interphase, which contains G1, S, and G2 stages).

In the M phase, the parent cell is divided into two daughter cell (through a sequence of 5 stages in the order- Prophase, metaphase, anaphase, telophase, and cytokinesis). The daughter cells have same number of chromosomes as that of the parent cell.

Prophase marks the beginning of M phase. In this phase, nuclear envelope is broken down and chromatin becomes condensed into visible chromosomes. Mitotic spindle formation is also initiated in this phase.

Thus, prophase is the right answer.

You might be interested in
Mutations in_ cells cause mutations to be passed on to the next generation
marysya [2.9K]

Answer:

TRUE

Explanation:

8 0
2 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What is the answer to this?
xeze [42]

Answer:

Explanation:

I think it is B

4 0
3 years ago
Describe the three types of predation and give an example of each.
uranmaximum [27]
<span>True predation is when a predator kills and eats its prey. Some predators of this type, such as jaguars, kill large prey. They tear it apart and chew it before eating it. Others, like bottlenose dolphins or snakes, may eat their prey whole. In some cases, the prey dies in the mouth or the digestive system of the predator. Baleen whales, for example, eat millions of plankton at once. The prey is digested afterward. True predators may hunt actively for prey, or they may sit and wait for prey to get within striking distance. In grazing , the predator eats part of the prey but does not usually kill it. You may have seen cows grazing on grass. The grass they eat grows back, so there is no real effect on the population. In the ocean, kelp (a type of seaweed) can regrow after being eaten by fish.</span>
3 0
2 years ago
Suppose it were possible to conduct sophisticated microscopic and chemical analyses of microfossils found in 3.5-billion-year-ol
soldier1979 [14.2K]

Answer:

The correct answer is option 3. a nucleus.

Explanation:

The first genetic material present in the early organisms were RNA which was present in the microscopic organisms back then 3.5 billion years ago which means it is normal to have RNA in such microfossils chemical analysis.

Since, the nucleus was not present in early life forms of prokaryotes like bacteria. so, it is unusual to find nucleus in the fossils of stromatolite rocks.

Thus, option III is the correct answer.

7 0
3 years ago
Other questions:
  • While mRNA strands are being created a sequence is sometimes miscopied. What is the best possible outcome, the worst possible ou
    9·1 answer
  • When would green plants carry out photosynthesis only during the day?
    10·1 answer
  • Scientists evaluate scientific evidence by using what
    15·1 answer
  • The neurons are the structural and functional units of the nervous system.
    8·1 answer
  • What is an example of a neuroendocrine gland?
    6·1 answer
  • If it is 2:20 and you add 43 minutes to it what time will it be
    13·2 answers
  • It make an excellent solvent for polar and ____ compound found within cells and tissuses
    14·1 answer
  • We know that DNA testing can
    11·1 answer
  • explain the relationship between structure and function for proteins include the term denaturation in your explanation name one
    9·1 answer
  • A student wrote the following observations in a field notebook: two grey wolves, five moose, several species of conifer trees, l
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!