1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivahew [28]
3 years ago
11

An example of mutualism would be

Biology
1 answer:
Katena32 [7]3 years ago
5 0
D is the correct answer
You might be interested in
What human actions contributed to the nutrient pollution of Lake Okeechobee?
alexdok [17]

Answer:

well i believe its the burning of coal and it releases nutrients

Explanation:

but other then that i dont know  but hope this helps 3 min

7 0
3 years ago
Most meteors _____.
Sergio039 [100]

Answer:

burn up in Earth's atmosphere

5 0
3 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Not counting the Domain, which of the following is the first level of classification? ​
brilliants [131]

Answer:

3 domains are archaea, bacteria and eukaryotes

5 kingdoms are animalia, plantae, fungi, protis,monera

then the classsifications are

kingdoms

phylum

class

order

family

genus

spicies

Explanation:

6 0
2 years ago
Which enzyme activate vitamin K in the liver and blocked by which drug?
frosja888 [35]

Answer:

menadione

Explanation:

Vitamin K is a fat soluble vitamin that exists in two natural forms: phytonadione (K1: fye toe" na dye' one) which is derived from plant sources and menadione (K2: men" a dye’ one) which is derived from bacterial sources. Vitamin K is a cofactor in the photosynthetic electron-transport system in green plants, which are the major dietary source of vitamin K for humans. High levels of vitamin K1 are found in leafy green vegetables while vitamin K2 is found in meat, milk and butter. In humans, vitamin K is an essential cofactor in the gamma-carboxylation of glutamate residues of several clotting factors and anticoagulant proteins. Hope this helps!

6 0
2 years ago
Other questions:
  • Please help with number two and three!!! Thanks
    12·1 answer
  • which is not true about the alternation of generations? the life cycle of a plant alternates between diploid and haploid phases.
    15·1 answer
  • A) Chromosome B) DNA nucleotide C) Codon D) Gene
    13·2 answers
  • In crocodiles, the sperm and egg combine inside the body of the female. Then the female lays the eggs, and the young develops ou
    12·1 answer
  • Read the information for transcription and then answer the question. Protein Synthesis Explain the process of transcription.
    9·2 answers
  • As of 2010, there are 118 known elements. of those, how many are believed to be essential to human biology?
    12·1 answer
  • The southern United States experiences periodic occurrences of severe cold and drought conditions. Which weather phenomenon most
    10·2 answers
  • Write five facts on motion and Newton's First Law.
    12·1 answer
  • A little help please??​
    6·1 answer
  • question 4: an atom with 7 protons, 6 neutrons, and 7 electrons, has an atomic mass of blank amu. (Enter a whole number) ​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!