During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
.
Explanation:
Do u have any options? or is it like ur suppose to write a paragraph?
Answer:
Dmitri Ivanovsky
Explanation:
Dmitri Ivanovsky utilized one of these filters in 1892 to demonstrate that despite being filtered, sap from a diseased tobacco plant remained infectious to healthy tobacco plants. The filtered, infectious substance was dubbed a "virus" by Martinus Beijerinck, and this discovery is regarded as the origin of virology.
Cells, the basic unit of life, are derived from spontaneous generation.
Hello, that is a very good question!
Back then there was no such thing as 'birth-control', hence they never actually prevented pregnancies, of course there were services that provided 'different' penetration but that could also result in pregnancies.
The popular method of not giving birth [prevent pregnancy] was to kill the baby while still carrying [termination], in other words have a miscarriage.
There many various methods during that time (herbs, beating, old cloth hanger).
Hope this helped,
j548831
