1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mash [69]
2 years ago
7

Wha is contained in chromosomes

Biology
2 answers:
zheka24 [161]2 years ago
6 0
Chromosomes contain histones which is dna coiled around proteins
Iteru [2.4K]2 years ago
5 0

Answer:

genes

Explanation:

chromosomes contain genes

You might be interested in
What important event in animal evolution marks the beginning of the Cambrian period?
Alenkinab [10]

The appearance of fossils would the the answer.

Although there has been some scientific debate about what fossil strata should mark the beginning of this period, the "International Geological Congress" determined that the Cambrian period was approximately 543 million years ago of which the first appearance in the fossil record of worms that made horizontal burrows was discovered.

3 0
4 years ago
Movement caused by gravity pulling the cooling/older lithosphere down the slope of mid ocean ridge which pushes the rest of the
zmey [24]

Answer:Ridge push

Explanation: hope this helps <3

5 0
2 years ago
Examine the following image. Which ocean-floor feature is indicated by the arrow in the image?
dimulka [17.4K]

Answer:

B. Guyot

Explanation:

What are guyots?

  • Guyots are very similar to seamounts, but they have a flat surface on the top rather than a pointy one. The image shown on the question is a guyot, as it's a seamount with a flat top.

What are seamounts?

  • Seamounts are basically underwater mountains on the ocean floor.

Have a lovely rest of your day/night, and good luck with your assignments! ♡

6 0
2 years ago
Full form of IUA in astronomy​
77julia77 [94]

Answer:

<em>IAU- International Astronomical Union</em>

Explanation:

The  International Astronomical Union (IAU) is an organization consisting of professional astronomers from around the whole world. The astronomers in the  International Astronomical Union (IAU) work together to assign names and probable functions of different celestial bodies being discovered. The aim of the  International Astronomical Union (IAU) is to protect and to safeguard field of astronomy and make progress in this field.

3 0
3 years ago
The American Psychological Association is the only organization that can approve psychological research studies. Please select t
pogonyaev
The statement "The American Psychological Association is the only organization that can approve psychological research studies." is false.

6 0
3 years ago
Other questions:
  • Which term refers to a physical characteristics that are studied in genetics?
    11·2 answers
  • Judah folkman performed an experiment in which he found that small tumors floating in the anterior chamber of the eye grew littl
    9·1 answer
  • What is the structure of that eggs, sperm, unrine and wastes all empty in to?
    13·1 answer
  • My teacher ‍ assigned a homework and I wrote it on my planner and it starts with organism am I doing this right or there talking
    11·1 answer
  • The biopsy technique in which only part of the lesion is cut out is a/ am
    9·1 answer
  • What name is given to the taste receptors and where are they found?
    11·1 answer
  • The cell cycle an mitosis
    9·2 answers
  • What is this plant tissue?
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • the chemiosmotic hypothesis states that the energy for the production of atp during photosynthesis comes from
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!