1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
1 year ago
5

The contraction of striated muscle is initiated by the release of energy in the presence of:

Biology
1 answer:
xeze [42]1 year ago
4 0

The contraction of striated muscle is initiated by the release of energy in the presence of <u>calcium ion</u>

<h3>What is a muscle?</h3>

A muscle can be defined as soft and band of fibrous tissue in a human or animal body that has the ability to contract to produce movements of the body parts

I'm conclusion, the contraction of striated muscle is initiated by the release of energy in the presence of calcium ion

Learn more about muscles:

brainly.com/question/1283837

#SPJ1

You might be interested in
Someone please help me with this Punnett square!! Rryy x rrYy
borishaifa [10]
Maybe this helps ? Please look at the picture

6 0
3 years ago
A learning process that can occur only during a limited period of the individual's development is called _____.
likoan [24]
This process is called as imprinting. It occurs at a particular stage of life and is, therefore, a phase-sensitive learning process. It can be of many types, including filial imprinting, where an offspring gains some of its behavioral characteristics from the parent, or sexual imprinting, through which desirable characteristics of a mate are recognized by a young animal. 
8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Viruses are parasitic, in that they require a host cell in order to go through the process of reproduction. When the influenza v
solmaris [256]
Lyric...............<span />
8 0
3 years ago
Read 2 more answers
Empirical evidence is obtained using our human senses, which statement
Inessa05 [86]

The statement “This type of evidence can be checked by others” best explains the importance of empirical evidence in science.

Explanation:

There are all kinds of evidence used in science, but empirical evidence is obtained as a result of <u>repeated experiments and observations</u>. This evidence is used to either support or argue against a scientific theory. Empirical evidence is the preferred evidence since this kind of evidence can be peer reviewed, i.e. reviewed by other scientists and/or researchers. In other words, the experiment can be redone, and the <u>evidence can be tested</u>.

8 0
3 years ago
Other questions:
  • Which event always involves a chemical change ?
    8·2 answers
  • How do new cells form in plants and animals?
    8·1 answer
  • Does the muscle tissue in your heart make up of long thin cells
    14·1 answer
  • Durante la expresión génica, el ADN se transcribe en ARN en el núcleo. Luego, el ARN se traduce en proteínas en el citoplasma. ¿
    14·1 answer
  • Please give a small paragraph quickly summarizing the what, when and how of each of the following techniques: PCR, DNA gel elect
    14·1 answer
  • What are large molecules made up of smaller molecules called?Untitled<br> Question
    14·1 answer
  • Consider this animal cell. Which organelles are labeled G? a) centrioles b)lysosomes c)endoplasmic d)reticulum-mitochondria
    7·2 answers
  • If 10 glucose molecules enter the Krebs Cycle, how many possible molecules of ATP can be produced?
    12·1 answer
  • What do you already know about the rotation and the revolution of the Earth?
    10·1 answer
  • The presence of what type of metal in the Cretaceous/Tertiary boundary may be evidence of an asteroid strike or volcanic activit
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!