1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
3 years ago
6

Kyle has 125 marbles. Fifty of these marbles are red and the reat are other colors. What is the ratio of the nunber of red marbl

es to the total of marbles expressed in simplest terms?
Mathematics
1 answer:
Vedmedyk [2.9K]3 years ago
4 0

Answer:

The required simplest form is: \frac{2}{5}

Step-by-step explanation:

We have been given Kyle has 125 marbles.

And 50 out of total 125 are red and rest of them are other colours

that means other colour marble are 125-50=75

we need to find ratio of the number of red marbles to the total of marbles  

The rat io is: \frac{50}{125}=\frac{2}{5}

The required simplest form is: \frac{2}{5}

You might be interested in
10 pts
Simora [160]
Area = pi * radius^2
radius = diameter/2 = 26/2 = 13 feet

Area = 3.14 * (13^2)
Area = 3.14 * 169 = 530.66 ft^2
4 0
3 years ago
Find how many quarts of 6?% butterfat milk and 3?% butterfat milk should be mixed to yield 30 quarts of 5?% butterfat milk
Mrrafil [7]

Answer:

The 20  quarts are used for 6% butterfat milk and 10 quarts are used for  3% butterfat milk .

Step-by-step explanation:

As given

6% butterfat milk and 3% butterfat milk should be mixed to yield 30 quarts of 5% butterfat milk .

Let us assume that x quarts are used for 6% butterfat milk .

Than (30 - x) quarts are used for 3% butterfat milk .

6% is written in the decimal form

= \frac{6}{100}

= 0.06

3% is written in the decimal form

= \frac{3}{100}

= 0.03

5% is written in the decimal form

= \frac{5}{100}

= 0.05

Than the equation becomes

0.06 × x + (30 - x) × 0.03 = 30 × 0.05

0.06x + 0.9 - 0.03x = 1.5

0.06x  - 0.03x = 1.5 - 0.9

0.03x  = 0.6

x = \frac{0.6}{0.03}

x = 20 quarts for 6% butterfat milk  .

(30 - x ) = (30 - 20) = 10 quarts for 3% butterfat milk  .

Than 20  quarts are used for 6% butterfat milk and 10 quarts are used for  3% butterfat milk .




5 0
4 years ago
Point P(−3, −4) is rotated 90° counterclockwise about the origin. What are the coordinates of its image after this transformatio
Neporo4naja [7]
Counter clockwise means it goes backwards so -90°

After the 90° counter clockwise rotation the coordinates are (4,-3)

7 0
4 years ago
Read 2 more answers
The ammunition storage room has 10 feet between the floor and the ceiling. Each box of ammunition is 10 feet tall. Each crate of
KIM [24]

Answer:

the maximum number of crates that can be stacked between the floor and ceiling

\frac{height \hspace{0.1cm} of  \hspace{0.1cm} ammunition \hspace{0.1cm} box}{height \hspace{0.1cm} of  \hspace{0.1cm} each \hspace{0.1cm} crate}  = \frac{10 \hspace{0.1cm}  feet}{12 \hspace{0.1cm}  inches}  =  \frac{10 \times 12  \hspace{0.1cm} inches }{12  \hspace{0.1cm} inches}  = 10 \hspace{0.1cm}  crates

where 1 foot  = 12 inches. SO the answer is that a maximum of 10 crates can be stacked from floor to ceiling.

Step-by-step explanation:

i) the maximum number of crates that can be stacked between the floor and ceiling

\frac{height \hspace{0.1cm} of  \hspace{0.1cm} ammunition \hspace{0.1cm} box}{height \hspace{0.1cm} of  \hspace{0.1cm} each \hspace{0.1cm} crate}  = \frac{10 \hspace{0.1cm}  feet}{12 \hspace{0.1cm}  inches}  =  \frac{10 \times 12  \hspace{0.1cm} inches }{12  \hspace{0.1cm} inches}  = 10 \hspace{0.1cm}  crates

where 1 foot  = 12 inches

3 0
3 years ago
In parallelogram ABCD,m
yan [13]

Answer:

After that????? Please ask me the full question please.

Thank you

5 0
3 years ago
Other questions:
  • How do I convert 57.9 to a mixed number??
    5·2 answers
  • What are the zeros of x^2-5x-1
    11·1 answer
  • Use the model to write an equivalent fraction 3 out of 4 = ______
    10·1 answer
  • What is 8/10 x 8/21
    12·2 answers
  • Simplify 12^0 times 12^6. Answer using an exponent
    6·1 answer
  • Which measure of central tendency is least appropriate for describing the given data set?. 6, 6, 6, 7, 8, 8, 29. . a. mode. b. m
    13·1 answer
  • Which ordered pair is a solution of 3y - 4x = 2?
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • OMG PLEASE HELP!!! And explain
    12·1 answer
  • Solve this for x let me know the answer pleas
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!