1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
2 years ago
10

(04.02 MC)

Health
1 answer:
earnstyle [38]2 years ago
3 0

Semantic Slanting is the demonstrated concept. So the correct option is D.

<h3>Semantic Slanting</h3>

A component of the art of persuasion, or "spin," is semantic slanting. It is the deliberate word selection and usage that seeks to persuade the audience to accept a point of view. Words can have nuances in meaning in addition to their basic meanings, as well as negative or positive connotations.

Examples of terms that describe odours in English include scent, aroma, odour, and stench. However, they each have their own perspective on fragrance depending on whether they associate it with being strong or delicate, pleasant or disagreeable.

Learn more about semantic slanting here:

brainly.com/question/2248441

#SPJ1

You might be interested in
Describe separate situations for when an authoritarian and delegative style of leadership would be utilized. (Site 2)
Angelina_Jolie [31]
An authority style is a pioneer's style of giving guidance, executing arrangements, and rousing individuals. Different creators have proposed recognizing a wide range of initiative styles as displayed by pioneers in the political, business or different fields

7 0
3 years ago
What is not true about cardiovascular activities?
Alex Ar [27]

Answer:B

Explanation:

7 0
3 years ago
Read 2 more answers
Sheri likes to study in the school library, but it is usually full of chatting students. It's a great place to study because her
jenyasd209 [6]

Answer:

<em>B. Less people</em>

Explanation:

Finding a quiet place and studying there is important because it helps to focus as there is less distraction, due to lack of distraction a person studying at a quiet place is able to understand and remember more, one can easily get over with their studies quickly, and  prevents incorrect information from being remembered.

So Sheri should find a quiet place where there are no people and it should be away from where her friends can find her, both crowd and friends are a big distraction for her.

5 0
3 years ago
Read 2 more answers
Irradiation as a method of food preservation is: ____
natta225 [31]

Answer: (A) best for many types of meat and some fruit.

Explanation:

Food irradiation is a type of food processing that actually extends from the shelf life and reduces the spoilage of food. The food items are exposed to the radiation to kill the pests, insects, microbes which could be responsible for the spoilage of food. The food is exposed to ionization radiation which can be either gamma or X-rays. Irradiation is not radioactive.

Foods like dairy products, eggs cannot be exposed to irradiation process, as it will change the texture and flavor of these food. Fruits, grains, meats and solid vegetables can be processed using irradiation.

According to the above explanation, A is the correct option.

6 0
3 years ago
Read 2 more answers
It's okay to ignore the rules of the game if the game officials don't notice true or false
zalisa [80]
False, even if they dont notice,  you still should play fair
6 0
3 years ago
Read 2 more answers
Other questions:
  • Jeff is one of the biggest pill pushers in our high school. Yesterday he offered you some of his brother's ADHD medication as a
    6·1 answer
  • The ability of a muscle to exert force is ________.
    12·2 answers
  • If a disease is associated with one socioeconomic group it will always be found in similar socioeconomic groups
    6·1 answer
  • Drag the tiles to the correct boxes to complete the pairs.
    12·1 answer
  • How can you reduce stress
    9·2 answers
  • Explain what you or the organisation can do to get involved in providing a safe and healthy environment in our community?
    14·1 answer
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • In this era the production of newspaper was made faster​
    11·1 answer
  • Compare and contrast Bob and Jimmy's characters​
    6·1 answer
  • A bicep curl is an example of which of the following type of lever
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!