1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr402 [8]
2 years ago
9

The controls of the windshield wiper and windshield washer are usually located on _______.

Biology
1 answer:
Darya [45]2 years ago
5 0

The controls of the windshield wiper and windshield washer are usually located on Right lever. Two levers on steering column contain controls for driving. .

A sun visor is located ion the above of windshield  also called windscreen . Designed with a flap that is adjustable to help shade the eye of drivers and passengers from the glare of sunlight.

The combination switch they flip beam switch or the directional switch that is on the left hand stalk signals and cancels turn indications when moved up or down.Automotive wipers are controlled by a microprocessor. windshield washer used to keep it clear for rain . snow , dust.

To learn more about the flap here

brainly.com/question/13336354

#SPJ4

You might be interested in
Living things come from other living things through either sexual or asexual reproduction.
Iteru [2.4K]

Explanation:

Organisms don’t have to only reproduce sexually or only reproduce asexually - some animals do both!

When conditions are good, such organisms will reproduce asexually because it is easier. For example, starfish (by fragmentation), slime molds, and water fleas/daphnia (by parthenogenesis) all reproduce asexually when there is plenty of food, minimal predators, and not too much crowding of individuals of the same species.

When conditions worsen (less food, too many individuals, etc), they may switch to sexual reproduction in order to add genetic variation to their population and ensure survival through difficult times.

brainliest and follow and thanks

7 0
3 years ago
Euglena are protists that move by means of flagella, and they contain chloroplasts and an eye spot or light receptor. they are c
Tatiana [17]
Whats the answer to this please
6 0
3 years ago
Read 2 more answers
What has the base Thymine?
goldfiish [28.3K]
Video: DNA: Adenine, Guanine, Cytosine, Thymine & Complementary Base Pairing. Learn the language of nucleotides as we look at the nitrogenous bases adenine, guanine, cytosine and thymine.

5 0
3 years ago
Most scientific questions are based on??
kow [346]
Usally biology or chemistry
8 0
3 years ago
Read 2 more answers
All of the following are examples of limiting factors except
elena-14-01-66 [18.8K]

Answer:

soil is the answer

6 0
3 years ago
Other questions:
  • Forms when a cooler air mass displaces a warmer air mass and usually indicates drops in temperature, heavy rains, and sometimes
    5·1 answer
  • Multiple alleles _____.
    14·2 answers
  • 18. Look at the figure above. Which position of the earth represents a solstice?
    12·2 answers
  • What animal is BEST adapted to life in a savanna biome
    8·2 answers
  • Which of the following contains saturated fat?
    5·1 answer
  • Plants and plant-like organisms make their energy (glucose) from
    11·1 answer
  • Cuál es la fórmula de vector aceleración?
    13·1 answer
  • A very hot type o star would most likelu enit its most intense radiation as​
    9·1 answer
  • To test the validity of their data, scientists take what actions?
    6·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!