1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
labwork [276]
1 year ago
14

During meiosis I, _____________________. Group of answer choices homologous chromosome pairs are separated the chromosome number

stays the same four daughter cells are formed sister chromatids are separated
Biology
1 answer:
spayn [35]1 year ago
7 0

Homologous chromosome pairs are separated

Meiosis 1 refers to the initial stage of meiosis where one parent cell divides into two daughter cells. This stage is where homologous pairs of chromosomes will segregate and separate from each other and move into the two daughter cells which result in the division of the total chromosomal number by half.

<h3>What happens during Meiosis 1 ?</h3>

Meiosis I ends when the chromosomes of each homologous pair arrive at opposing poles of the cell.

  • The microtubules disintegrate, and a new nuclear membrane forms around each haploid set of chromosomes.

  • The chromosomes uncoil, forming chromatin again, and cytokinesis occurs, forming two non-identical daughter cells.

Learn more about Meiosis here:

brainly.com/question/8253366

#SPJ4

You might be interested in
Please i need help with this....
steposvetlana [31]

Answer:

Punnett squares

W is dominant

w is recessive

       W            w

W    WW        Ww

w     Ww        ww

Explanation:

Punnett squares

W is dominant

w is recessive

       W            w

W    WW        Ww

w     Ww        ww

3 0
2 years ago
State the structure by which the embryo develops and grows.
netineya [11]

Answer:

the structure by which the embryo is called the oblica cord

4 0
2 years ago
Read 2 more answers
Which of the following is a way that new DNA can be introduced to bacteria?
OLEGan [10]

Answer:

B

Explanation:

<em>The correct answer here would be that </em><em>it can be injected by a virus.</em>

Since a virus operates by taking over the genetic system of the host and uses its replication, transcription, and translation to make virions or viral particles through the lytic or lysogenic life cycle. In the process, if the virus is utilized as a vector to carry a foreign DNA, the DNA is introduced into the genome of the bacteria. This is exactly what happens during the process known as transduction.

<em>The correct option is, therefore, </em><em>B.</em>

4 0
3 years ago
What does hypo mean
Marysya12 [62]

Answer:

There are many explanations.

Explanation:

1) It is "the chemical sodium thiosulphate (formerly called hyposulphite) used as a photographic fixer."

2) another word for hypodermic

3) an attack of hypoglycemia

4) under; below

Hope this helps you! ;)

7 0
3 years ago
Read 2 more answers
What part of Arkansas are the crops grown?
Genrish500 [490]

The production of these crops is centered in the eastern third of the state but there are notable concentrations elsewhere, particularly in the river valleys of the Arkansas River (central Arkansas) and the Red River (southwest Arkansas).

5 0
3 years ago
Other questions:
  • Describe how fossils help us understand the past
    15·1 answer
  • Which is an area located within the alpine tundra? A. Sonoran Desert B. Amazon Rainforest C. Himalaya Mountains D. Australian Tr
    5·1 answer
  • The structures of amino acids differ from each other in that:
    7·2 answers
  • The diagram represents one of Mendel’s laws or principles of inheritance. mc014-1.jpg Which law or principle does the diagram re
    7·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why is ocean water more dense than fresh water at the same temp?
    10·2 answers
  • Unmyelinated axons have _____ because the signal must make its way down the entire length of the axon.
    12·1 answer
  • True or false: autosomes are sex chromosomes
    13·2 answers
  • What is the kinetic energy of a 0.05 kg golfball that is rolling at 3 meters
    10·1 answer
  • Identify the structures from the image. <br><br>A - <br>B - <br>C - <br>D - <br>E -<br>F -​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!