Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
The answer is A. Most lichen species are unaffected by the forest fire
Yes, the pterosaurs is the ancestor of the bird.
Answer;
-The bacterium would exhibit positive chemotaxis.
Explanation;
-Chemotaxis is the movement of cells or organisms in response to chemicals, whereby the cells are attracted (positive chemotaxis) or repelled (negative chemotaxis) by substances exhibiting chemical properties.
Flavonoids play a crucial role as signal molecules in promoting the formation of nodules by symbiotic bacteria commonly known as rhizobia. The roots of leguminous plants use positive chemotaxis to attract rhizobia. Flavonoids are the chemicals associated with attraction of Rhizobium bacteria.