1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inessss [21]
2 years ago
10

Plan a good post-workout meal with both carbs to replace _________________ stores and protein for muscle ______________ and repa

ir.
Biology
1 answer:
podryga [215]2 years ago
5 0

Plan a good post-workout meal with both carbs to replace energy stores and protein for muscle tired and repair.

<h3>Energy </h3>

Energy is the quantifiable attribute that is transferred to a body or a physical system in physics. It is observable in the production of work as well as in the form of heat and light. Energy can be transformed in form but cannot be created or destroyed, according to the rule of conservation of energy. The definition of a joule, the SI unit used to measure energy, is "the energy imparted to an object by the work of moving it a distance of one metre against a force of one newton."

Learn more about energy here:

brainly.com/question/1932868

#SPJ4

You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Researchers are studying lichens growing on trees in a forest
vesna_86 [32]

Answer:

The answer is A. Most lichen species are unaffected by the forest fire

7 0
3 years ago
What are 6 characteristics of living things
lubasha [3.4K]

Answer:

Explanation:

  1. movement
  2. growth and development.
  3. response to stimuli.
  4. reproduction
  5. use of energy.
  6. cellular structure.
4 0
3 years ago
Did birds evolve from the gliding reptiles called pterosaurs?
Law Incorporation [45]
Yes, the pterosaurs is the ancestor of the bird. 
5 0
3 years ago
Read 2 more answers
From what you should now know about bacterial taxis and nodule formation, predict how a rhizobium would respond to a flavonoid.
andreev551 [17]

Answer;

-The bacterium would exhibit positive chemotaxis.

Explanation;

-Chemotaxis is the movement of cells or organisms in response to chemicals, whereby the cells are attracted (positive chemotaxis) or repelled (negative chemotaxis) by substances exhibiting chemical properties.

Flavonoids play a crucial role as signal molecules in promoting the formation of nodules by symbiotic bacteria commonly known as rhizobia. The roots of leguminous plants use positive chemotaxis to attract rhizobia. Flavonoids are the chemicals associated with attraction of Rhizobium bacteria.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Microwaves are produced when
    7·1 answer
  • A client has a mean arterial blood pressure (map) of 97 mmhg and an intracranial pressure (icp) of 12 mmhg. what is the cerebral
    9·1 answer
  • Which of these is a method of obtaining oil? A. Tar sands extraction B. Coal mining C. Surface mining D. Underground mining
    11·1 answer
  • how can a mutaion affect protein synthesis by a cell? Do you think there are different consequence if it happens in a gamete cel
    15·1 answer
  • During what stage of photosynthesis is o2 produced
    10·1 answer
  • The polar head of a phospholipid is made of _____ molecules.
    10·1 answer
  • Two populations of a species of flightless bird became separated by a river and the birds became two different species. How woul
    8·1 answer
  • Put them in order pleaseeeee
    12·2 answers
  • Alfred Wegener was a meteorologist that had access to modern _____
    7·1 answer
  • Plant viruses spread throughout the plant by way of __________. View Available Hint(s)for Part A chloroplasts plasmodesmata vert
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!