1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artemon [7]
2 years ago
8

During the t wave of the electrocardiogram, the ventricles are electrically ________ and functionally ________

Biology
1 answer:
KATRIN_1 [288]2 years ago
5 0

During the t wave of the electrocardiogram, the ventricles are electrically repolarizing and functionally relaxing.

The T Wave shows ventricular repolarization when the ventricles relax after contracting and depolarizing. The ST segment shows the period between ventricular depolarization and repolarization, which is the space (a flat or slightly upcurved line) between the S wave and the T wave.

Although absent or downward sloping ST segments may suggest myocardial ischemia, a raised ST segment is the typical sign of myocardial infarctions. The U wave, which denotes the repolarization of the Purkinje fibres, comes after the T wave.

Because it is a relatively little wave in relation to the others, it does not usually appear on an ECG.

To learn more about T wave click here

brainly.com/question/15733842

#SPJ4

You might be interested in
Which part of the chloroplast is responsible for absorbing light energy from the sun​
Fantom [35]
The absorption of light energy and its conversion into chemical energy occurs in multiprotein complexes, called photosystems, located in the thylakoid membrane.
5 0
3 years ago
Which statement is true of the X chromosome?
alexgriva [62]

Answer:

The correct option is D

Explanation:

A male sperm needs a x chromosome and y chromosome , whereas a female sperm needs 2 x chromosomes , Thus both genders needing x chromosome

4 0
2 years ago
What will most likely happen to the population of bison that feed on the grass
Mandarinka [93]
If a portion of the grass was destroyed by wildfire, then the population of bison that feed on the grass will decrease. This is because there would be very little grass left for them to eat, and they don't eat anything else.
6 0
3 years ago
HELP◑﹏◐!
exis [7]
The answer is d I juss took the test
5 0
4 years ago
Read 2 more answers
(5 points)
Sphinxa [80]

Answer:

Groundwater is the water available under Earth's surface in soil pore spaces and in the fractures of rock formations. A unit of rock also known as a unconsolidated deposit is called an aquifer when it can yield a usable quantity of water.

Explanation:

7 0
3 years ago
Other questions:
  • What does Eukaryopolis mean?
    13·2 answers
  • In which mitotic phase do the chromosomes condense and does the mitotic spindle begin to form? See section 12.2 (page 258) ?
    7·1 answer
  • PLEASE HELP!
    5·1 answer
  • The bones in the wings of a bat are the same as the bones found in the front paws of a raccoon. Their function is very different
    13·1 answer
  • 1. Algae are plantlike organisms that live in the water. These algae have been in sunlight for several
    15·1 answer
  • Why were Cynognathus fossils were important to Wegener's theory?
    10·1 answer
  • What do we call a virus that attacks a bacterium?
    15·1 answer
  • A "code" for organisms genetic makeup or allele combinations; this is found in our DNA/chemicals. A.phenotype B.Genetics C.Genot
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • En que conciste la funcion de relacion?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!