Answer:
The second option.
Explanation:
We're trying to test the amount of bleach that has an effect on the stain so that is the altered variable.
The 2nd option uses different amounts of bleach to clean the same amount of stain.
If you choose the other options, people can argue that the bigger stain would be harder to clean with one cup of bleach, whereas the small stain gets two cups or the other way around.
It's not an effective way to see if the amount of bleach has an effect on stain removal.
He means its more then just what your genes give you its what you can overall think of
Answer:
symbiosis.
Explanation:
The term that you are referring to is symbiosis. (a symbiotic relationship)
Symbiosis is a proximate and often long-term interaction between two or more different biological species.
It would be an opaque Object <span />
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.