1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liula [17]
1 year ago
8

"Bt maize"

Biology
1 answer:
Maurinko [17]1 year ago
3 0

The correct is option (C) includes bacterial genes that produce a toxin that reduces damage from insect pests.

Due to advancements in plant biology, some plant species can now incorporate unique traits that are typically not found in their species. New and improved plant strains can be created using plant biotechnology. This technology is heavily utilized to advance agriculture.

A particular crystalline insecticidal protein is created by combining a specific gene sequence from the bacteria Bacillus thuringiensis with plants. Bt plant is a common name for these transgenic plants. One such transgenic plant that protects transgenic maize from damaging insects and pests is bt maize.

Learn more about maize here:-

brainly.com/question/28250112?referrer=searchResults

#SPJ4

You might be interested in
Which is a biological effect of the hydrogen bonding between molecules of water
vaieri [72.5K]

Living things can survive in the water beneath a lake's frozen surface/

Hope this helps!


-Payshence


6 0
3 years ago
PLEASE HELP! URGENT!
Minchanka [31]

If temperatures are too high, the leaves from these delicate plants will whilt and die. If there is too much rain, the leaves will fall off and the plant will lose it natural beauty. High temperatures affect animals because the can become too dehydrated and can lack energy and strength, this can be negative if they are being hunted. Too much rain affects animals because they can struggle to find shelter in the rain and can get caught up in an overflow of muddy water.

7 0
3 years ago
Final Practice: Read each statement. If the statement is true, write “T”. If the statement is false, write “F”.
gavmur [86]

Answer:

F, i just guessed because I do not see the statements

Explanation:

5 0
3 years ago
18
Usimov [2.4K]

Answer:

Explanation:

Ok first. Are you from mr.goodfriend's class? cause i know a safina and you questions are almost the same as the quiz thats due tommorow. Oh and it's b i think

5 0
2 years ago
When oceanic and continental plates converge, the oceanic plate tends to go under the continental plate and eventually melts. Wh
MrRissso [65]
I believe it is C- volcanic mountains
6 0
2 years ago
Other questions:
  • Diseases such as the flu are spread through contact with contaminated respiratory droplets in _____ transmission.
    13·1 answer
  • What is the result when DNA ligase has completed its job?
    8·2 answers
  • Suppose only one gene with 2 alleles determines a particular trait but the alleles are codominant. how mant different phenotypes
    6·1 answer
  • The kingdom monera in the old classification system included all bacteria what two kingdoms now encompass prokaryotes organisms
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Select the characteristics of life. Choose ALL that apply.
    14·1 answer
  • One main difference between dementia and delirium is that delirium only affects people over the age of 65. Please select the bes
    5·2 answers
  • When two monomers come together to make a polymer, a molecule of what is released? a.NO2 b.CO2 c.H2O d.H2O2
    6·1 answer
  • Why pith is absent in dicot root​
    14·1 answer
  • In what aspects do minerals differ from eachother​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!