1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
CaHeK987 [17]
3 years ago
7

Which of the following choices is the best example of how the cell membrane and mitochondria might work together to make energy

in a particular cell?
A. In animal cells, the mitochondria allows materials in and out of the cell, while the cell membrane uses nutrients to make energy (ATP) for the cell.

B. In a plant cell, the mitochondria allows materials in and out of the cell, while the cell wall makes food for the cell by photosynthesis.

C. In a plant cell, the cell wall allows materials in and out of the cell, while the mitochondria makes food for the cell by photosynthesis.

D. In animal cells, the cell membrane allows materials in and out of the cell, while the mitochondria uses nutrients to make energy (ATP) for the cell.
Biology
2 answers:
never [62]3 years ago
7 0
The answer is D. in animal cells, the cell membrane allows materials in and out of the cell, while the mitochondria uses nutrients to make energy (ATP) for the cell.
dem82 [27]3 years ago
4 0
The answer would be a B c d
You might be interested in
HELP PLEASE VERY URGENT!!!!!!!!!! FREE POINTS AFTER
Fynjy0 [20]
Pick b just pick b I know its right I have hade the same one
3 0
3 years ago
Read 2 more answers
Suppose we were successful in identifying 12 mutants using a screen for identifying conditional mutants of S. cerevisiae in whic
Marina CMI [18]

Answer:

Each mutant would be mated to wild type and to every other mutant to create diploid strains. The diploids would be assayed for growth at permissive and restrictive temperature. Diploids formed by mating a mutant to a wild type that can grow at restrictive temperatures identify the mutation as recessive. Only recessive mutations can be studied using complementation analysis. Diploids formed by mating two recessive mutants identify mutations in the same gene if the diploid cannot grow at restrictive temperature (non-complementation), and they identify mutations in different genes if the diploids can grow at restrictive temperature (complementation).

Explanation:

Recessive mutations are those whose phenotypic effects are only visible in homo-zygous individuals. Moreover, a complementation test is a genetic technique used to determine if two different mutations associated with a phenotype colocalize in the same <em>locus</em> (i.e., they are alleles of the same gene) or affect two different <em>loci</em>.  In diploid (2n) organisms, this test is performed by crossing two homo-zygous recessive mutants and then observing whether offspring have the wild-type phenotype. When two different recessive mutations localize in different <em>loci</em>, they can be considered as 'complementary' since the heterozygote condition may rescue the function lost in homo-zygous recessive mutants. In consequence, when two recessive mutations are combined in the same genetic background (i.e., in the same individual) and they produce the same phenotype, it is possible to determine that both mutations are alleles of the same gene/<em>locus</em>.

5 0
2 years ago
Which of the following pairs is not a correct monomer/polymer pairing?
ahrayia [7]
C, triglyceride and cellulose

triglycerides make up lipids. cellulose is not a lipid, but a carbohydrate. carbohydrates are made from sugars :)
8 0
3 years ago
How does acid precipitation cause rocks to weather faster?
larisa86 [58]
Because it causes them to move, and so they weather that way. Buut the acid rain can leak into the rock and slowly break down the atoms, causing it to chemically weather faster. Also, just regular water/rain can wash away some covering sediment.
5 0
3 years ago
What structural features do cellulose and glycogen share, and in what ways do they differ?.
d1i1m1o1n [39]

Answer:

Option (b) Both are polymers of D-glucose but cellulose is connected by ( beta 1-4 ) glycosidic linkage whereas glycogen is connected by ( alpha1-4) glycosidic linkage....

Explanation:

:)

3 0
2 years ago
Other questions:
  • _ is a hormone which causes _to be broken down to form _.
    14·1 answer
  • The rn recognizes that in cases of conflict involving client care decisions which principle overrides beneficence
    11·1 answer
  • The rapid growth of the human population during the last two centuries is INDIRECTLY responsible for which environmental concern
    5·1 answer
  • Name the structures and functions of the integumentary system
    5·1 answer
  • What is the flower part that elevates the anther
    6·2 answers
  • The amplitude on a transverse wave is
    15·1 answer
  • What are the stages Of mitosis?
    10·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What are the products of photosynthesis? (5 Points glucose and oxygen glucose and carbon dioxide carbon dioxide and ATP ​
    10·1 answer
  • GlaxoSmithKline would become more ________ if it starts allowing its lab scientists to set the priorities and allocate the resou
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!