1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jekas [21]
3 years ago
15

How many ways can you choose ten tadpoles from a pool of 20?

Biology
1 answer:
mestny [16]3 years ago
5 0
What do you mean but if you mean what I think you mean then you take half of the tadpoles 
You might be interested in
What are the five characteristics that all minerals have in common?
Paul [167]
Naturally ocurring, solid,inorganic, Crystal shape, and definite chemical composition.
6 0
3 years ago
Why do you seldom see fossils in metamorphic rocks?
Sergeu [11.5K]

Answer:

Metamorphic rocks have been put under great pressure, heated, squashed or stretched, and fossils do not usually survive these extreme conditions.

Explanation:

8 0
3 years ago
What is the difference between eukaryotic and prokaryotic cells?
natali 33 [55]
Eukaryotic cells are mostly found in Archea and multicellular organisms meanwhile prokaryotic cells are found in unicellular.  The major difference between the two is eukaryotic cells have a nucleus, or a nucleotide region. Therefore I believe the answer is C. 
3 0
4 years ago
. Identify where the main bones in the body are located and which type of bone they are.
Bogdan [553]

Answer:five types of bones in the skeleton: flat, long, short, irregular, and sesamoid.

Explanation:

5 0
3 years ago
Can you please help me with this?
ruslelena [56]
The aquifer must be permeable and porous to allow the water to flow through.
5 0
3 years ago
Other questions:
  • ou have obtained genome nucleic acid from different sources and have determined the base content. Please identify the genome str
    14·1 answer
  • Which of the following accurately describes the angiosperm plant life cycle? A. The ovary is haploid. B. The ovule develops into
    12·2 answers
  • To study the effect of price on Brett's demand for rock climbing lessons economists hold his monthly income constant. This is an
    5·1 answer
  • Name a hormone that acts to raise blood calcium.
    12·1 answer
  • Judge the following sentence according to the criteria given below: Reef-building corals are not able to survive in nutrient-poo
    9·1 answer
  • When Mendel crossed purebred purple flowering plants (PP) with purebred white flowering plants (pp), what were the flower colors
    13·1 answer
  • Why is the temperature in Seattle more stable than Minneapolis, even though they are at similar latitudes
    9·1 answer
  • 4. The genetic code that is a blueprint for our physical traits is called a
    10·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • What is the speed of grid method in forensics
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!