I think it's the evaporation of water through the stomata :)
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Explanation:
After repeated stimulation by antigen, B cells can make antibodies that bind their antigen with much higher affinity a process called affinity maturation. ... Thus, antigen stimulation greatly increases the antibody arsenal. Antibodies are proteins, and proteins are encoded by genes.
Answer;
Amino acid side chains have many carboxyl and amino groups.
Explanation;
-A buffer solution is a solution that resists changes in pH when small quantities of an acid or an alkali are added to it. It is a chemical substance that helps maintain a relatively constant pH in a solution, even in the face of addition of acids or bases.
-Buffering is important in living systems as a means of maintaining a fairly constant internal environment, also known as homeostasis.Small molecules such as bicarbonate and phosphate provide buffering capacity as do other substances, such as hemoglobin and other proteins.
-
Protein buffer systems depend upon proteins, as opposed to nonprotein molecules, to act as buffers and consume small amounts of acid or base. Since amino acids have the capability of reacting with both acid and base, they naturally act as buffers.
Answer: A
Explanation: Just took the quiz