1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
3 years ago
5

Brings dry, clear weather

Biology
1 answer:
Alborosie3 years ago
4 0
Summer? Idek your question
You might be interested in
Population living in one place form a
garik1379 [7]
Population living in one place form a Community!
6 0
3 years ago
Which of these would speed up the rate of a chemical reaction
Sveta_85 [38]
Kinetics is the study of the speed of a chemical reaction some chemical reactions are fast others are slow sometimes chemists want to speed the slow ones up and slow the fast ones down
8 0
3 years ago
Primary producers are the basis of any food chain. Sunlight powers photosynthesis which results in the production of chemical en
I am Lyosha [343]

Answer:

A) Chemosynthesis

Explanation:

Organisms, such as bacteria and other living organisms, use chemosynthesis when there is an absence of light. They use inorganic chemicals to produce energy through reactions.

8 0
3 years ago
Which of the few is not a defining characteristic of water?
patriot [66]

Answer:

D

Explanation:

Low Specific Heat Capacity

4 0
2 years ago
Builder a was able to underbid his competitor, builder b, by secretly using a lower grade cement when building swimming pools.bo
snow_tiger [21]

Answer:

builder A

Explanation:

got it right

4 0
2 years ago
Other questions:
  • Which of the flowing is a benifit that many flowerinf plants get from animals
    12·1 answer
  • The human body has about 10 bacterial cells for every eukaryotic cell. Bacteria coat our skin, gut, and mouth. Also present are
    12·1 answer
  • Mona lives in North Carolina. She takes an overnight flight to California to visit with family for a month; when she arrives she
    9·1 answer
  • The soil on a plain is eroded and the grass starts to die. Grazing animals that live on the plain would probably
    6·2 answers
  • Which of the following has the stages of getting food products to consumers in the
    9·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • How is an ionic bond different than a covalent bond?
    8·1 answer
  • Proteins can be denatured in many ways.
    12·2 answers
  • Which statements describe steps taking place in the nitrogen cycle shown above?
    8·1 answer
  • What is the phenotype for females
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!