1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
2 years ago
9

which list contains an item that does not belong with the others? please choose the correct answer from the following choices, a

nd then select the submit answer button. answer choices sympathetic nervous system, increases heart rate, slows digestion parasympathetic nervous system, increases respiration, stimulates digestion sympathetic nervous system, dilates pupils, relaxes bladder parasympathetic nervous system, contracts pupils, stimulates blood flow to the genitals
Biology
1 answer:
Shalnov [3]2 years ago
7 0

Answer: parasympathetic nervous system increase respiration stimulates digestion

Explanation:

i took one for the team

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
When two substances create a solution, what happens to its mass?
marissa [1.9K]
The mass is increased as two things are added together so the two masses of the two substances are added together.
7 0
2 years ago
What is the Primary cortex
VashaNatasha [74]
The primary<span> motor </span>cortex<span> (Brodmann area 4) is a brain region that in humans is located in the dorsal portion of the frontal lobe.</span>
6 0
3 years ago
What types of plants are the first to arrive
lozanna [386]

The first land plants appeared around 470 million years ago, during the Ordovician period, when life was diversifying rapidly. They were non-vascular plants, like mosses and liverworts, that didn't have deep roots

6 0
3 years ago
Which os these statements best sums up evolution?
cestrela7 [59]
<span>Evolution can best be summed up by statement D - change in a population through genetic variation over time. The other statements do not refer to evolutionary changes, as these are changes that occur slowly, rather than suddely or with speed.</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • According to researchers the greatest threat to wild species is
    12·1 answer
  • When compared to generation x, members of generation y are most likely to influence?
    13·1 answer
  • Why does active transport take place in the small intestine during absorption of food molecules? I thought it was only diffusion
    11·1 answer
  • What does an animal do when it respires
    9·1 answer
  • What is the meaning of girth in biology
    14·2 answers
  • Which of the following is a characteristic of the tidal region of an ocean
    6·1 answer
  • A team led by evolutionary biologist Hopi Hoekstra set out to test the hypothesis that predators are an agent of natural selecti
    9·1 answer
  • A student made a model of an onion skin cell she viewed using a microscope. The scale is 1:500.The students cell model has a len
    13·2 answers
  • Answering by analyzing this picture.
    7·2 answers
  • This is it thank you
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!