1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
6

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

fteenth base was changed from a G to a T. Fill in the corresponding mRNA, tRNA, and letter in the blanks spaces for the mutated DNA strip. Explain how this point mutation changes the protein.

Biology
1 answer:
jekas [21]3 years ago
5 0

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

You might be interested in
WORTH 15 PTS!!!!
postnew [5]
I believe the answer is C.
7 0
3 years ago
Read 2 more answers
Kac tane doku vardir
koban [17]

Answer:

I think you may have spelled it wrong

Explanation:

3 0
3 years ago
Help? I've read parts I need to like 20 times over and I need help.
lutik1710 [3]
Can you give anymore information?
7 0
3 years ago
The _____ in the brain contributes to the body's maintenance of a steady internal physiological state, called _____.
AleksandrR [38]
The hypothalamus in the brain contributes to the body's maintenance of a steady internal physiological state, called homeostasis. 
7 0
4 years ago
Read 2 more answers
Why doesn't glucose belong in the lungs?
Alenkinab [10]

Answer:

glucose transport in the lung and its role in lliquid movement

7 0
3 years ago
Other questions:
  • Select all that apply. The five major striated muscle groups in the body are _____. neck arms chest abdominals hands legs back f
    14·2 answers
  • A gunshot wound to the back of the head would cause the victim to be permanently unable to maintain motor coordination. the part
    11·1 answer
  • Alma is planning on joining the track team this year. In preparation for the season, Alma decides she wants to start
    12·1 answer
  • Rather than being located randomly throughout the brain,neurons that do a particular job are arranged in lobes.Why might this be
    14·1 answer
  • If a DNA molecule is 22% adenine in any organism, which percentage of thymine will that DNA molecule contain?
    11·1 answer
  • Which cell would doctors conclude is a cancerous mass?<br><br> A. A<br> B. B<br> C. C<br> D. C
    9·1 answer
  • BRAINLIESTTT!! PLEASE HELP ASAP:)
    5·2 answers
  • Give reason for : the plants with falling leaves can do the transpiration process in
    14·1 answer
  • Which is a correct observation based on the photo shown below?
    13·1 answer
  • In which situation is energy released by a plant?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!