Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
fteenth base was changed from a G to a T. Fill in the corresponding mRNA, tRNA, and letter in the blanks spaces for the mutated DNA strip. Explain how this point mutation changes the protein.
1 answer:
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
You might be interested in
Answer: See attached picture.
Explanation:
DNA or deoxyribonucleic acid is the name for the molecule that contains the genetic information in all living things. This molecule consists of two strands that wind around each other to form a double helix structure.
The basic unit of nucleic acids are called nucleotides, which are organic molecules formed by the covalent bonding of a nucleoside (a pentose which is a type of sugar and a nitrogenous base) and a phosphate group. So each nucleotide is made up of a pentose sugar called deoxyribose, a nitrogenous base which can be adenine (A), thymine (T), cytosine (C) or guanine (G) and a phosphate group.
<u>What distinguishes one polynucleotide from another is the nitrogenous base</u>, and thus the sequence of DNA is specified by naming only the sequence of its bases. The sequential arrangement of these four bases along the chain is what encodes the genetic information, following the following criterion of complementarity: A-T and G-C. So the sequence of these bases along the chain is what encodes the instructions for forming proteins and RNA molecules. In living organisms, DNA occurs as a double strand of nucleotides, in which the two strands are linked together by connections called hydrogen bridges.
The chemical convention of naming the carbon atoms in the pentose nucleotide pentose numerically confers the names 5' end and 3' end ("five prime end" and "three prime end" respectively). The 5'-end designates the end of a DNA strand that coincides with the phosphate group of the fifth carbon of the respective terminal deoxyribose. A phosphate group attached to the 5'-end allows the ligation of two nucleotides; for example, the covalent bonding of the 5'-phosphate group to the 3'-hydroxyl group of another nucleotide, to form a phosphodiester bond.
