1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
6

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

fteenth base was changed from a G to a T. Fill in the corresponding mRNA, tRNA, and letter in the blanks spaces for the mutated DNA strip. Explain how this point mutation changes the protein.

Biology
1 answer:
jekas [21]3 years ago
5 0

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

You might be interested in
How do volcanoes form at B?
ELEN [110]
That is a subduction or convergent boundary that can form volcanoes when two plates collide against each other.
4 0
3 years ago
Read 2 more answers
A solution of an enzyme normally found in the human body was added to a flask containing a solution of proteins in distilled wat
Nata [24]

Answer: 1. increase the temperature from 27 degrees Celsius to 37 degrees Celsius

Explanation:

Generally, protease function optimally at temperature range of 55 to 60 degrees Celsius and at lower pH 5.0 to 5.5. Hence increase in temperature to 37 degrees Celsius will increase proteolysis.

3 0
3 years ago
When you breathe, the pressure inside the lungs is different than the pressure outside the lungs. this is an example of a(n)?
goblinko [34]

The pressure inside your lungs and the pressure outside them fluctuate as you breathe. An illustration of a pressure gradient is this.

<h3>What is an example of pressure gradient?</h3>
  • The pressure gradient is the amount by which the atmospheric pressure drops in a location at a particular time.
  • A pressure gradient is demonstrated by gale-force winds in one city changing to a moderate breeze after an hour. the rate of the pressure in space decreasing (gradient) at a specific period.
<h3>How does pulmonary ventilation change with pressure gradient?</h3>

Thoracic ventilation Because air moves down a pressure gradient, or from an area of greater pressure to an area of lower pressure, the difference in pressures is what drives pulmonary ventilation.

When breathing in and out, the respiratory airways restrict the flow of air. The air must be transported by the pressure gradient from the mount (or nose) to the pulmonary alveoli.

learn more about pressure gradient here

brainly.com/question/2530102

#SPJ4

5 0
2 years ago
A ---------- is the thing that destroys other things​
ycow [4]

Answer:

virus aka a bug

Explanation:

5 0
3 years ago
A purulent wound produces ________.
ddd [48]

Answer:

A purulent wound produces fluid which are releases from the purulent wound. Basically, it is the type of the fluid which are produced in the form of milky type and it is the symptoms of the infection in the body. It is also known as purulent drainage, which are basically the sign of infection in the wound or hole in the skin of our body and then it needs proper treatment.  

4 0
3 years ago
Other questions:
  • What does a magnetic field tell us about two magnets placed side-by-side
    10·1 answer
  • If you spend a lot of time in the sun, then you will increase your risk of skin cancer. Manipulated variable (Independent Variab
    10·2 answers
  • What is plant "blinking"? Why do plants do this?
    15·1 answer
  • If we removed the decomposers from this food web, how would it affect the balance of the ecosystem? A.)There would be an increas
    8·2 answers
  • I need help pls someone
    10·2 answers
  • BRAINLIEST
    5·2 answers
  • To take in matter or energy<br> collection<br> liver<br> composition<br> absorption<br> Ok
    9·1 answer
  • Pls help me u have to do scenario
    8·1 answer
  • In Arizona, monsoon season generally runs during the summer months heading into September. The heaviest rainfall in Arizona usua
    6·1 answer
  • Which data would not affect maximum likelihood estimates of phylogenies when comparing different tree hypotheses?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!