1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viktelen [127]
2 years ago
12

Inorganic elements that are extracted from the soil by plants and passed up the food chain are known as?

Biology
1 answer:
Anarel [89]2 years ago
8 0

Inorganic elements that are extracted from the soil by plants and passed up the food chain are known a Minerals.

  • Minerals are inorganic compounds that make up the majority of the soil solution; among those needed by plants for structure and control are nitrogen (N) and potassium (K).
  • Plants nevertheless need inorganic salts, which they take up from the soil around their roots. These salts contain the elements phosphorus (in the form of phosphate), chlorine (as the chloride ion), potassium, sulphur, calcium, magnesium, iron, manganese, boron, copper, and zinc.
  • Group of creatures arranged from producers to consumers in the food chain, as well as prey, predators, scavengers, and decomposers. food chain. noun. each connected food chain within an ecosystem. Likewise known as a feeding cycle.

To learn more about Minerals.

brainly.com/question/18078524

#SPJ4

You might be interested in
a solid substance turns into a liquid. which best describes this change? a substance that has a specific volume changes to a sub
BartSMP [9]
A substance that has a specific shape and volume changes to a substance that has a specific volume is the statement that best describes this change in question. The correct option among all the options that are given in the question is the third option. I hope the answer helps you.
8 0
4 years ago
Read 2 more answers
What does it mean when scientists say that living organisms share a universal genetic code?
lesya [120]
When scientists say they share a universal genetic code it means that all organisms it can mean either DNA as the main source of hereditary information in all life forms we know of  or more likely that all organisms we know of use a three base pair code for the synthesis of proteins, DNA produces mRNA. This mRNA is read three base pairs at a time by a ribosome and this is called the genetic code.

<span>I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question. ok</span>
3 0
3 years ago
Read 2 more answers
Explain the stages involved in testing a piece of onion for reducing sugar​
Gre4nikov [31]

Explanation:

<u>Reducing sugars are simple sugars with the ability to reduce copper (II) ions to copper (I). All monosaccharides (fructose, glucose, galactose) are reducing sugars as are some disaccharides, such as lactose and maltose. Simple sugars are all carbohydrates, and are used by the body as a source of energy.</u>

\huge\bold\red     {Befikra❥☘⍣❦}

3 0
2 years ago
PLEASE HELP
jekas [21]
Shark,big fish, small fish,algae,plankton hope this helped
3 0
3 years ago
In cuba, reed, carroll, and lazear fought against which disease?
djverab [1.8K]
I'm pretty sure it was yellow fever.
7 0
4 years ago
Other questions:
  • Which relationship will increase a population's size
    10·2 answers
  • What kind of biomolecule can store more energy than others?
    14·1 answer
  • All of the following describe the molecular/cellular changes that occur in cones in response to light, except one. Choose the ex
    8·1 answer
  • A biome is best described as a major type of ecosystem with _____.
    10·1 answer
  • Fitness is:
    9·1 answer
  • Compare and contrast Xylem and phloen<br>​
    8·1 answer
  • WILL MARK BRAINLYEST<br> PLEASE HELP WITH THIS
    13·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which of the following question must be asked about the use of resources in an economic system
    7·1 answer
  • How are Recessive and dominant alleles alike?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!