Answer:
C
Explanation:
you have 1 full square and 1/4 of the other square, making 1 1/4
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Yes, sure!
1) Moving Water - Water, when running for a long period of time, can actually start to weather rocks.
2) <span>Ice wedging - Yep, this can cause rocks to weather as well. Water, when being constantly frozen and unfrozen weathers the rock due to the fact that water is able to expand.
</span>
3) Plant Roots - Ah, these little nutrient grabbers can certainly weather rocks over periods of time.
4) Winds - Winds can certainly physically weather the rocks, and it's probably the most common way they do.
<span>P.S. If this answer helped you, please, make sure to say "Thanks" just below my answer. It will help me a lot</span>
<span>Archaeas and Bacterias are both Prokaryotes. Both used to be classified in Monera kingdom, but later genetists found that they have actually very different genes, despite they both have a similar metabolism. So they think they have a totally different evolutionary origin and they decided to classify them in 2 different domains. The other domain, Eukarya, includes every other organism (all the ones who are not Prokaryots), which are: plants, animals, fungi and protists.</span>