1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Galina-37 [17]
2 years ago
9

True or False: Repetition Practice interferes with the ability to learn new information

Biology
1 answer:
ankoles [38]2 years ago
8 0

Repetition Practice interferes with the ability to learn new information is true.

It is impossible to overstate the value of repetition. In fact, it needs to be emphasized again how important repetition is as a learning tool. It enables the transfer of a conscious skill into the subconscious, freeing up working memory and enabling the acquisition of new skills. Repetition gives kids the practice they need to acquire new skills, so it's a good thing. Repetition helps kids learn faster, builds confidence, and fortifies the neural connections in their brains that support learning. Practice doesn't always make perfect while learning a new skill. Zachariah Reagh and Michael Yassa, neurobiologists at UC Irvine, discovered that while repetition improves the factual content of memories, it can decrease the amount of detail associated with such memories.

Learn more about repetition here-

brainly.com/question/28084537

#SPJ9

You might be interested in
What is the similar in meaning of dishonour​
zavuch27 [327]

Answer:

disgrace

shame

discredit

humiliation

degradation

ignominy

Explanation:

6 0
2 years ago
19. Identify the appropriate mixed number for the picture
irga5000 [103]

Answer:

C

Explanation:

you have 1 full square and 1/4 of the other square, making 1 1/4

3 0
2 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Can someone give me 4 examples of physical weathering
valkas [14]
Yes, sure!

1) Moving Water - Water, when running for a long period of time, can actually start to weather rocks.

2) <span>Ice wedging - Yep, this can cause rocks to weather as well. Water, when being constantly frozen and unfrozen weathers the rock due to the fact that water is able to expand.
</span>
3) Plant Roots - Ah, these little nutrient grabbers can certainly weather rocks over periods of time.

4) Winds - Winds can certainly physically weather the rocks, and it's probably the most common way they do.


<span>P.S. If this answer helped you, please, make sure to say "Thanks" just below my answer. It will help me a lot</span>
4 0
3 years ago
These cells are part of the domains Archaea and Bacteria.
satela [25.4K]
<span>Archaeas and Bacterias are both Prokaryotes. Both used to be classified in Monera kingdom, but later genetists found that they have actually very different genes, despite they both have a similar metabolism. So they think they have a totally different evolutionary origin and they decided to classify them in 2 different domains. The other domain, Eukarya, includes every other organism (all the ones who are not Prokaryots), which are: plants, animals, fungi and protists.</span>
8 0
2 years ago
Other questions:
  • Which type of bacteria can be found in pairs chains squares of four cubes of eight or grape like clusters
    15·1 answer
  • Air can be disinfected using __________
    15·1 answer
  • Volcanic eruptions can cause _____.
    11·2 answers
  • ______found evidence that the continents were joined together at one time.
    10·1 answer
  • What is the other side of the following DNA strand: ACCTGGTAACGT
    13·1 answer
  • A cold blooded animal that notices
    10·1 answer
  • Which of the following terms is used to describe how part or parts of an organism work?
    13·1 answer
  • Anemia is caused by a defective gene resulting in abnormal hemoglobin: a. Hemorrhagic anemia b. Aplastic Anemia c. Pernicous Ane
    11·1 answer
  • Answer these 3 questions and I will give the brainiest
    14·1 answer
  • How is atmospheric carbon in the form of CO2 converted into a molecule that
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!