1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NeX [460]
1 year ago
12

For a(n) __________ operon, transcription normally takes place, and it is turned off by a(n) ________

Biology
1 answer:
netineya [11]1 year ago
4 0

For a(n) repressible operon, transcription normally takes place, and it is turned off by a(n) active repressor.

<h3>What is repressible operon ?</h3>

An operon that is normally on but that can be turned off in the presence of a repressor molecule is referred to as repressible. The repressor binds to the operator in such a way that it prevents RNA polymerase from moving or attaching, which prevents transcription from starting.

<h3>What is active repressor?</h3>

A protein that prevents the expression of one or more genes is known as a repressor in the context of genomics. The repressor protein inhibits the synthesis of messenger RNA by attaching to the promoter region of the gene(s) (mRNA). The control of gene expression in cells requires repressor proteins.

To know more about repressible operon visit :

brainly.com/question/13794408

#SPJ4

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional
elena-14-01-66 [18.8K]

Answer:

Aerobic glycolysis has a slow rate of ATP production and is predominantly utilized during longer-duration, lower-intensity activities after the phosphagen and anaerobic systems have fatigued. It is important to remember that all three of these systems contribute to the energy needs of the body during physical activity

Can I get brainliest so I can reach the next rank?

8 0
3 years ago
Read 2 more answers
I'LL MARK U AS BRAINLIST FRIST PERSON 2 ANSWER!!!!
Andrew [12]

Answer:

B

Explanation:

6 0
3 years ago
What factors limited human population growth in the past?
lapo4ka [179]

Answer:

Limiting factors include a low food supply and lack of space. Limiting factors can lower birth rates, increase death rates, or lead to emigration. When organisms face limiting factors, they show logistic growth (S-shaped curve, curve B: Figure below).

Explanation:

3 0
3 years ago
Read 2 more answers
Help pleaseeee???????
IRINA_888 [86]

Answer:

Written below.

Explanation:

5. During meiosis, a reproductive cell and its nucleus divide twice and produce four cells––two pairs of identical haploid cells.

6. Homologous chromosomes are two pieces of DNA within a diploid organism that carry the same genes, one from each parental source. In simpler terms, both of your parents provide a complete genome. Each parent provides the same 23 chromosomes, which encode the same genes.

3 0
2 years ago
Read 2 more answers
Other questions:
  • Gavin turned 4 years old and received vaccinations at his yearly physical examination. what type of immunity will gavin develop
    14·2 answers
  • When a new species originates from two or more individuals of a preexisting species, we call this?
    11·1 answer
  • B В
    10·1 answer
  • Alonte is viewing a cell under a microscope.
    12·2 answers
  • Which is a goal of the Human Genome Project?
    10·2 answers
  • The difference between prokaryotic and
    5·1 answer
  • Im not very sure about this
    14·1 answer
  • Which of the following is an external stimulus? O A hunger O B. sunlight O c. instinct OD. tropism​
    15·1 answer
  • Which characteristics do all bony and jawless fish have in common? Check all that apply.
    5·2 answers
  • State four(4) benefits of the earth's rotation to the environment.​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!