1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]3 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
Why are so many big cities located along the banks of a river
Flura [38]

The cities, especially the largest ones have almost always been located along the banks of a river, usually a larger one. ... In the past, a major reason was the fertile soil, as the larger population needed more food, and the fertile deposits by the rivers enable high scale production of food. ( cite: google )

6 0
4 years ago
Read 2 more answers
Heat flows from what substances ?
Archy [21]

radiation is the transfer of heat through an open space

conduction is the flow of through a liquid

convection is the transfer of heat through direct contact

or

Heat is the movement of thermal energy from a substance at a higher temperature to another at a lower temperature. heat is thermal energy moving from a warmer object to a cooler object?? heat is transferred by the movement of currents within a fluid.

7 0
4 years ago
Read 2 more answers
What do chicken muscles tissues attach to
garri49 [273]

Answer:

they attach to the bones.

4 0
3 years ago
Select the item if it helps organisms keep their shape.
krek1111 [17]
This one is only c.skin
4 0
3 years ago
Read 2 more answers
People with sickle-cell trait:____.
Irina18 [472]

The answer is all of the above.

What is sickle-cell trait?

Red blood cells with sickle cell disease are bent rather than spherical because it is an inherited blood ailment. Small blood vessels are blocked by these curved red blood cells. Organ damage and suffering may result from improper blood flow.

Option e (all of the above) is the correct choice.

To learn more about sickle-cell trait, click on the link below –

brainly.com/question/13291966

#SPJ4

8 0
2 years ago
Other questions:
  • Through ___ Larger molecules are formed .
    5·1 answer
  • Question 8 options:<br> If the mRNA reads AGC, what will be the tRNA anticodon?
    10·1 answer
  • Which is a function of protein macromolecules?​
    6·2 answers
  • What hormone does the adrenal gland produce?
    14·2 answers
  • What is a sentence for the word scientific inquiry
    5·1 answer
  • In which part of a cell does transcription take place
    7·1 answer
  • What energy source is used to make products, such as gasoline, plastics, and Vasoline?
    11·1 answer
  • Which planet is terrestrial?<br><br> A Jupiter<br> B Mars<br> C Saturn<br> D Uranus
    12·2 answers
  • Why does oxygen from our lungs diffuse into the bloodstream?
    14·1 answer
  • TRansition gets the code from DNA?<br>1.true<br>2.false​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!