1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
2 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]2 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
Do bigger organisms have bigger cells what kind of test could you do to answer this
Assoli18 [71]

No, bigger organisms have more cells.
3 0
3 years ago
Read 2 more answers
HELP PLS NOW LOOK AT MY PROFILE FOR MORE QUESTIONS
eduard

Answer:

Im pretty sure its A :)

Explanation:

deoxyribose

​Nucleotide

A nucleotide consists of a sugar molecule (either ribose in RNA or deoxyribose in DNA) attached to a phosphate group and a nitrogen-containing base.

ribose

The five-carbon sugar in DNA is called deoxyribose, while in RNA, the sugar is ribose.

4 0
3 years ago
In this assignment, you will write a story about how different foods travel through the digestive and excretory system from the
Reika [66]

d health

are explained on a nutrient level. The connection

of nutrients to dietary choices begins. Proteins,

Carbohydrates (aka “carbs”), Fats, Minerals,

Vitamins and Water are defined as the major

nutrient groups.

Focus and Engage

■ This chapter will make the students aware of the

food choices they make.

■ Help the students learn to evaluate foods for

nutritional quality.

■ Encourage the students to understand their

bodies’ needs.

Introduce the Section

a. Encourage the students to be aware of the varied

food choices available to them.

b. Discuss new food options and ideas with the

students.

c. Help the students to realize that nutrition is a

science, not just an opinion or a feeling.

2 Chapter 1 ■ The Food You Eat

1 The Food You Eat

Have you ever wondered how the food you eat fuels your body?

Why some foods make your body feel and perform better than others? Nutrition has the answers. The more you know about nutrition,

the better you will be able to make food choices that will keep you

healthy and strong and keep your body functioning optimally.

Adequate nutrition can help prevent certain diseases, maintain an

optimal body weight, and give you more energy to participate in the

activities you enjoy. There are six essential nutrients in the human

diet. Take a look at what’s on the menu in your school cafeteria

today, and see if you can identify items that contain these nutrients.

In This Chapter,

You Will . . .

■ Understand the science of

nutrition

■ Learn how proteins, carbohydrates, and fats comprise the

foods you eat

■ Learn about the benefits of

vitamins, minerals, and water

■ Discover what calories are and

how they are calculated

■ Learn about food additives

such as flavor enhancers,

preservatives, and coloring

Why YOU Need to Know This

2

Advance PreparationUSDA nutrient database (www.nal.usda.gov)

FDA Web site for label reading (www.cfsan.fda.gov)

Prepare Students will need colored pencils or markers

Paper for graphic organizers

Pop-beads—small costume jewelry or large baby toys that connect

Index cards or small pieces of paper

7 0
3 years ago
Read 2 more answers
3. Summarize why the definition of species had changed over time
Tasya [4]

Answer:

Originally, the distinction was based on morphological differences. However, it soon became that some types of organisms had different forms at various stages in their lives, here is why

Explanation:

changed genes is passed on to the next generation. Most mutations are bad, but some of them make the organism more successful in its life. Organisms that inherit that favorable new gene are likely to become more abundant than others of the species. (geologic times)

3 0
3 years ago
Tran wants to live a long and healthy life. the most important thing he can do to improve longevity is:
Marta_Voda [28]
Daily exercise and a healthy well-balanced diet.
7 0
3 years ago
Read 2 more answers
Other questions:
  • As global warming continues, the oceans absorb more of the Earth’s heat. What term describes the ocean as a storage location for
    7·1 answer
  • 12. What does it mean to be a recessive allele?<br> a. Give an example:
    6·2 answers
  • What are the 4 basic steps for DNA extraction?
    9·1 answer
  • 15. Which is not a problem associated with the increased use of nuclear energy?
    10·1 answer
  • Microbial population growth is represented bu the graph.Based on this model we would expect the population growth of this colony
    5·2 answers
  • Which of the following is NOT likely to cause increased rates of mutation in an organism
    15·2 answers
  • _____ assumes that intellectual disability is a consequence of a disease process or biological defect.
    11·1 answer
  • Where in the cell is atp produced
    6·1 answer
  • The law that states that the force of gravity acts between all objects in the universe that have mass is
    13·1 answer
  • I need this now,I'll give you 100 points for answer 10 questions.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!