1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]3 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
What do the letters inside the grid of a punnett square represent?
Aneli [31]

Answer:

The correct answer is - Genotype of the offspring

Explanation:

Punnet square is a diagram which is used to predict and show the genotype of offspring that is produced by a cross between male and female gametes. This approach was given by Reginald C. Punnett.

Each grid have a genotype that can determine the phenotype of offspring. The letters used in to fill these grids can be made up of uppercase letters, lower case letters or both. The allele shown in upper case letters shows that the allele is dominant and the allele which is in lowercase letter is a recessive allele.

Therefore the letters inside the grid of a punnet square represents the genotype of the offsprings.

4 0
3 years ago
Someone do this plese! will give brainlist and alot of points
mario62 [17]

Answer:

Hi Hi really sorry may i get some points i need them to give it to other people cuz some people want points, ik its not the answer u wanted sorry but hope u get the answer soon!

Explanation:

3 0
2 years ago
99 POINTS Please help?!?! How can a chromosone regulate transcription and increase it?
mezya [45]
C the region that codes for rna folds 


i don't know if this is right i tried 
5 0
3 years ago
Read 2 more answers
What does a host cell provide for a virus? *
mojhsa [17]

Answer:

C

Explanation:

3 0
3 years ago
Read 2 more answers
Which causes plants to respond positively to sunlight
posledela
Auxins.

Hope this helped!
4 0
3 years ago
Other questions:
  • A. 0%<br> B. 25%<br> C. 50%<br> D 75%
    5·2 answers
  • How sharp claws of eagle help in adaptation?​
    8·1 answer
  • Explain if a plant was in a very dry environment, how diffusion and osmosis be affected?​
    10·1 answer
  • What are the SI units of measurement (in science)
    15·2 answers
  • Do anaerobic organisms still exist? If no, why not? If yes, give two examples.
    8·2 answers
  • What two environmental factors influence the shape of proteins?
    6·1 answer
  • The largest biome is the
    12·2 answers
  • Convection occurs because heated material becomes ____________________. A less dense and rises B denser and rises C denser and s
    14·1 answer
  • Everyone<br><br>plz do j,oin<br><br>through<br>g,oogle<br>m,eet<br><br><br>jtoessthpr​
    5·1 answer
  • How does carbon dioxide concentration affect photosynthesis rate?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!