1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]3 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
Chromosomes often exchange segments of DNA during meiosis. How might this increase the survival of a species?
il63 [147K]

Answer:

Because of recombination and independent assortment in meiosis, each gamete contains a different set of DNA. This produces a unique combination of genes in the resulting zygote. Recombination or crossing over occurs during prophase

4 0
3 years ago
Which of the following structural adaptations helps an organism obtain food?
lutik1710 [3]

I think its C. The long neck of a giraffe

8 0
3 years ago
Yearly rainfall-12–30 inches; mild summers, cold winters - _________________
Fudgin [204]

Yearly rainfall-12–30 inches; mild summers, cold winters are considered as weather conditions.

<u>Explanation:</u>

To understand the basic difference between the weather condition and climate let’s look into the basic difference. Weather condition is the condition that is been experienced whereas the climate is a condition that is expected to be happening for a long period of time.

Here mild summer and cold winners are the weather condition of that place.  Climate will be the average weather of that particular region. While weather is the condition observed during that particular period climate is the condition observed for years together.

8 0
3 years ago
True or false? Antacids are substances that behave like acids to neutralize bases
igomit [66]
The correct answer is true hope this helps! ^0^ :)
8 0
4 years ago
A cell is placed in a water solution with the same salt concentration as the cell. The cell is placed in a _____.
Nikolay [14]
Isotonic solution. Hypotonic is less salt concentration and hypertonic is more
4 0
3 years ago
Read 2 more answers
Other questions:
  • 14. What is the carbon cycle?
    9·2 answers
  • To be useful in the scientific method, an observation must be:
    8·1 answer
  • Biologists often determine population density by capturing animals and marking them for later identification upon recapture. A b
    11·1 answer
  • Where are the protons and neutrons located in an atom?
    13·2 answers
  • Which example is an organism?<br> a. fungus<br> b. brain cell<br> c. granite<br> d. ruby
    15·1 answer
  • What connection do all living things have with each other
    8·2 answers
  • What would happen if your heart valves stopped working?
    5·1 answer
  • Задание 1: a) по рисунку определите особенности формирования мужских и женских гамет у животных и растений в фазах митоза I и II
    7·1 answer
  • Identify the statement which is not true
    10·1 answer
  • True or False: By using Biomimicry to solve the bullet trains noise problem the train also became more fuel efficient.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!