1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]3 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
What are two examples of nuclei acids?
cricket20 [7]

Answer:

dna

and

rna

are the two types

4 0
3 years ago
Read 2 more answers
Please help
tia_tia [17]

Answer:

True

Explanation:

During contraction of skeletal muscle fibers, the thin filaments slide inward toward the A band's center as a result of cycles of crossbridge binding and bending.

8 0
3 years ago
Read 2 more answers
Polyploidy in plants can lead to
sp2606 [1]

Answer:

E

Explanation:

I think bcuz arises as the result of total nondisjunction of chromosomes during mitosis or meiosi

3 0
3 years ago
Categorize the following: intestinal muscles, heart muscles, hand muscles, and neck muscles.
Pie

Answer:

The given muscles can be categorized into following categories:

Smooth muscles: These are involuntary muscles and non-striated muscles which are usually found within the walls of internal organs such as stomach, intestine, uterus et cetera.

Cardiac muscles: These are involuntary and striated muscles which are only associated with the heart.

Skeletal muscles: These are voluntary in nature and striated in structure. They are anchored to the bones with the help of tendons. They help in skeletal movement such as maintaining posture, locomotion et cetera. For example, hand muscles and neck muscles.

3 0
3 years ago
Read 2 more answers
After recording the damage encountered in a load, what should be done with the damaged cases?
kupik [55]
The thing you need to do with the damage cases is mark them as damaged and report it immediately to a supervisor, after recording the damage encountered in a load. Tell and report the damage cases immediately or as soon as possible to a higher rank in the company or to the supervisor when you are done marking it as damaged.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Amniocentesis is a process in which amniotic fluid is taken from the mother's womb to identify any genetic abnormalities in the
    7·2 answers
  • The Earth is about 4.6 billion years old. However, the oldest sea floor is only about 180 million years old. What do you think i
    10·1 answer
  • A nurse administers methenamine cautiously to a client with a history of which condition?
    6·1 answer
  • A student was given a task to observe a bacterial specimen made from dilute yogurt and sketch the shape of bacteria seen. He dre
    10·2 answers
  • How is factor used differently in math and science?
    15·1 answer
  • List and describe 4 features of the ocean floor
    5·1 answer
  • Marge is an ace at tennis. she does not miss a ball! She has great balance and coordination. The part of Marge’s brain that help
    7·1 answer
  • Which of the following statements is true?
    7·2 answers
  • Which process best describes how water cycled through plants in the water cycle?
    12·2 answers
  • Compare and contrast geological tilt and fold. (1 point)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!