1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]3 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
Match the receptor to the place it is most commonly found on an animal's body. 1. chemoreceptors skin 2. mechanoreceptors nose 3
allochka39001 [22]
The photoreceptors would be your eyes, chemoreceptors skin, olfactory for nose and mechanoreceptors for obviously tongue hope this helps.
6 0
3 years ago
Read 2 more answers
10 POINTS
tatiyna

Answer:

The answer is C

Explanation:

8 0
3 years ago
The layers of earth are based on what two sets of characteristics?
katovenus [111]
Chemical composition and physical properties
7 0
3 years ago
Which type of movement does not occur at the shoulder joint? which type of movement does not occur at the shoulder joint? abduct
Elena-2011 [213]

The answer is gliding. Abduction, rotation (external and internal) and extension all occur in most joints including the ball-and-socket , saddle and condyloid joints. The shoulder joint is a ball-socket joint. Gliding occurs in intercarpal joints of the hands.


7 0
3 years ago
Describe the changes that occur in the male and female reproductive systems during puberty.
RoseWind [281]
During puberty the testes of the man will begin to produce testosterone. This causes hair growth in multiple areas of the body and the voice change. Similarly, women begin to grow hair but also begin menstruation.
4 0
3 years ago
Other questions:
  • The fundamental cause of sickle-cell disease is a change in the structure of:
    11·1 answer
  • GUYS PLSS HELP if you know!!! ASAP!!
    10·2 answers
  • Treadmiling contributes to actin based motility
    5·1 answer
  • You pull out of the school parking lot and almost enter the road in front of an oncoming truck. For the next several minutes, yo
    9·2 answers
  • Dr. Kettlewelll predicted that clean forests would have _____________ colored moths, and polluted forests would have _________ c
    9·1 answer
  • Which factors changed throughout the experiment? Check all that apply.
    9·1 answer
  • The period during which a heart chamber is contracting is called . 2. The period during which a heart chamber is relaxing is cal
    13·1 answer
  • 20. An agent that causes infections and disease
    13·1 answer
  • A shipment of 288 reams of paper was delivered. Each of the 30 classrooms received an equal share of
    6·1 answer
  • Which of these is
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!