1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]3 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
Which occurs during translation but not during transcription?
nevsk [136]

Answer: The process wherein the DNA is copied to RNA is called the transcription and translation is when RNA is used to produce protein.

Explanation:

5 0
3 years ago
What do you think might happen if someone had a mutation that didn’t allow their body to make carbonic anhydrase?
GuDViN [60]

Answer:

they would die

Explanation:

5 0
3 years ago
Structure of bronchi definition
Korvikt [17]
The bronchi (singular: bronchus) are the airways that lead from the trachea into the lungs, and then branch into smaller bronchioles. Structurally, the bronchi are made up of cartilage that gives them stability and prevents their collapse.
3 0
3 years ago
RNA is used in the process of translation to build proteins. Which of these correctly describes the role of the different types
navik [9.2K]

Answer:

A) rRNA makes up the ribosome.

B) tRNA carries amino acids to ribosome.

E) mRNA code is read to determine the sequence of amino acids in the protein.

Explanation:

6 0
3 years ago
Insects can cause loss of tree productivity and even death. TRUE or FALSE.
vovangra [49]
True insects can loss tree productivity and even death
7 0
3 years ago
Other questions:
  • EXPLAIN the difference between qualitative and quantitative data. Give examples to support your responses.
    7·2 answers
  • What causes thermal convection that drives plate motion?
    11·2 answers
  • _____ help fertilize the soil by shedding digestive material
    10·2 answers
  • What is the correct answer ? explain why and please answer this !!
    8·1 answer
  • Environmental sustainability is the responsible interaction with the environment to avoid depletion or degradation of natural re
    11·1 answer
  • Which of the following describe quantitative data?
    13·2 answers
  • Which best describes that earliest land plants
    10·2 answers
  • What color light is being reflected by green plants?
    11·1 answer
  • Give the systematic position of malarial parasite ?
    11·1 answer
  • Help!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!