1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]3 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
How do plankton differ from nekton? plankton are floaters. plankton are strong swimmers. plankton live on the ocean bottom. plan
kobusy [5.1K]
The answer is plankton are floaters. Plankton and nekton are both marine aquatic organisms. The main difference between the two is that plankton tend to float and be carried by water currents while nekton are organisms that swim against the current of the water. Plankton are passive swimmers while neekton are active swimmers.
4 0
3 years ago
Read 2 more answers
Which protists have cells walls and reproduce by forming spores
Diano4ka-milaya [45]

Answer:

Fungi-like protists.

Explanation:

7 0
3 years ago
During dna replication, the two strands separate as the ____________ bonds connecting the parent strands are broken by an enzyme
Setler79 [48]
During DNA replication, the two strands separate as the hydrogen bonds connecting the parent strands are broken by an enzyme called helicase. In the DNA molecule (double strand) complementary bases are joined by hydrogen bonds; that is; Adenine paired to thyamine and guanine to cytosine; during replication the enzyme helicase separates the double helix by breaking the hydrogen bonds between the complementary bases. 
3 0
3 years ago
The serous fluid within the pericardial cavity works to:____.
Feliz [49]

The serous fluid within the pericardial cavity works to lubricate the membranes of the serous pericardium. It is the space between the layers of the pericardium.

<h3>What is the pericardial cavity?</h3>

The pericardial cavity refers to the space between different layers of the pericardium in the heart.

The pericardium is one of the three tissues that form the heart (i.e., pericardium, myocardium, and endocardium).

The pericardial cavity is composed of a serous fluid capable of reducing surface tension and lubricating this layer.

Learn more about the  pericardial cavity here:

brainly.com/question/2833911

6 0
2 years ago
Explain how natural selection helps the survival of a species.
Artyom0805 [142]

According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Is a starfish living or non- living explain why
    5·1 answer
  • A certain minivan has a
    5·1 answer
  • What was the most significant conclusion that gregor mendel drew from his experiments with pea plants?
    8·1 answer
  • Which describes the process of a bacterial cell dividing to create two daughter cells?
    10·2 answers
  • Like DNA, RNA contains four nitrogenous bases. Three of them are the same as those found in DNA.
    15·1 answer
  • A scientist is studying the fossil record to construct an evolutionary lineage for an order of fishes. The scientist proposes th
    13·1 answer
  • Compare and contrast prokaryotes and eukaryotes
    7·1 answer
  • Snails have a diploid chromosome number of 22. After meiosis, the snail’s sperm or egg would have 11 chromosomes. How many chrom
    6·2 answers
  • Which process can be primarily affected by gallbladder disease <br>​
    5·2 answers
  • Tissue specific gene regulation is primarily controlled by
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!