1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]3 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
Color (black/gray/red) is a ___________ characteristic
Reil [10]

Their are three main characteristic is intensity, saturation, and hue .

Red color is motivated by power, black is achromatic color with hue  like white gray and white.black is symbol of darkness.  Brightly co-loured object is one that reflects and transmits a large portion of light falling on it.

The great amount of light is reflected on white screen while a black screen would not reflects any light. Co-lour  also linked with various personality trait , motivation and productivity levels in life. It symbolize life and death , love and evil and happiness and anger.Red color makes you feel passionate and energized.

To learn more about motivation here

brainly.com/question/972761

#SPJ4

7 0
2 years ago
What arrangement of electrons would result in a non-polar molecule
Allisa [31]
The Electrons would need to be in a covalent bond. Covalent means that the electrons are equally shared between atoms.

Please mark as brainliest if this helped you:)))
7 0
3 years ago
How does the work of the National Oceanic and Atmospheric Administration help people?
Tomtit [17]
A is the answer ur welcome for helping u
6 0
3 years ago
Read 2 more answers
PLEASE HELP
Lelu [443]

The best kind of model for the scientist to use is an interactive model of the planets' orbits on a computer.

<h3>What is the law of orbits?</h3>

Kepler's first law, also known as the law of orbits, describes the shape of planetary orbits. According to this law, the planet's orbits around the Sun are elliptical, despite having very small eccentricities.

For this reason, it is necessary to know all the orbits of the planets in an interactive way, since according to Kepler's law, the orbits decrease over time.

See more about orbits at brainly.com/question/18914648

#SPJ1

8 0
2 years ago
Guinea pig coat color is determined by a single gene. The allele for black coat color is dominant to brown. In a cross between t
Gwar [14]

Answer:

In a cross between two black-haired guinea pigs, 20 offspring are born. If both parents were heterozygous, probability would predict that approximately 1 out of 20 offspring would have brown hair

Explanation:

The two parents crossed were heterozygous dominant black coat color, after crossing 75% gives dominant black color coat while 25% gives only brown coat color homozygous

7 0
3 years ago
Other questions:
  • Particles closest together in which state of matter
    5·2 answers
  • Cultivation of seafood under controlled conditions is called
    8·1 answer
  • What are the four differences between plant and animal cells ?
    8·1 answer
  • PLEASE ANSWER QUICK!!
    6·1 answer
  • What gases create our atmosphere?
    14·1 answer
  • Why do saturated fatty acids have straight structures, while unsaturated fatty acids have bent structures?​
    15·2 answers
  • Please help me here the picture
    5·1 answer
  • Endangered species are ?
    5·1 answer
  • If everyone on the planet used the same amount of resources as an average American, what percent of the Earth would
    6·1 answer
  • 7. Considere un sistema que contiene un mol de un gas monoatómico retenidito por un pistón. ¿Cuál es el cambio de energía intern
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!