1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]3 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
100 POINTS!! Pls help!
Olegator [25]
All I know is lahat ng may Down Syndromes is same lahat ng face
6 0
2 years ago
A scientific prediction or possible explanation for an observed phenomenon is known as a(n):
stellarik [79]
The answer would be a theory 
3 0
3 years ago
Which of the following bases is not present in dna?
Yakvenalex [24]
Uracil user is not present in dna
3 0
3 years ago
The Citric acid cycle occurs in the mitochondria. There are nine biochemical reactions involved in the Citric acid cycle, and th
Sauron [17]

Answer:

. 2C- acetyl Co-A from the link reaction  enters the kreb Cycle to combine with 4 Carbon Oxaloacetate to form 6-  Citrate

The Citrate forms intermediate Isocitrate, which eventually formed  6-C alpha ketoglutarate.

The alpha-ketoglutarate forms the intermediate succinyl-Co A, which later formed  5C-succinate.

5C -Succinate  forms 4C-fumarate, the latter formed 4C-malate- which eventually formed 4C-oxaloacetate.

The 4C of these compounds is fixed, to ensure constant availability of 4C of oxaloacatate for 2C Acetyl -CoA to bind it for the cycle to continuously occur for production of first product Citric Acid  from which other products are  formed from.

Explanation:

5 0
4 years ago
Similarities and difference between unspecialised plant cell and animal cell​
ss7ja [257]

Answer:

Easy, here you go .p.

Explanation:

Similar:

-They are both Eukaryotic cells

-Both contain a Nucleus

-Both contain Mitochondria

-Both contain a Golgi Apparatus

Difference:

-Plant cell contains a cell wall and cytoplasm.

-Animal cells have only small vacuoles and do not contain plastids.

I hope this helps have a great day my loves <3

4 0
2 years ago
Other questions:
  • Plants are ?
    12·2 answers
  • What is a map? Pls let me know
    5·2 answers
  • According to the theory developed by Charles Darwin, what process causes organisms to develop traits that help them adapt to cha
    15·1 answer
  • A 2-day-old infant who weighs 6 lb (2722 g) is fed formula every 4 hours. newborns require about 73 ml of fluid per pound (454 g
    10·1 answer
  • The bacteria and archaea include microscopic prokaryotes that lack membrane-bound nuclei. what criteria have lead to the classif
    14·1 answer
  • Colder ocean water is generally found where? (Pick 2)
    14·2 answers
  • HELP ASAP HELPPPPPPPPPPPPPPPPPPPPPP
    8·1 answer
  • Definition of respiration​
    13·2 answers
  • Why does it help to organize data in a table?
    11·2 answers
  • The main dietary factor associated with elevated blood cholesterol is?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!