1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
2 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

e DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
1 answer:
IgorC [24]2 years ago
5 0
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
You might be interested in
What stage ensures that each cell receives an identical set of DNA during mitosis?
EleoNora [17]
I think it’s telophase
Hope that helped sorry if it’s wrong
3 0
2 years ago
DNA ___________ is important because it ensures that when a cell divides, the two resulting cells have the same genetic code. Pl
slega [8]

Answer: Replication

Explanation: When the cell is preparing to divide it will <u>replicate</u> its DNA so that both of the daughter cells will have a complete set of the DNA. It's like a book of instructions and the cell has to perfectly replicate it so that when it splits into two both of the new cells will have a perfectly made copy of it! Hope this helps :)

8 0
2 years ago
What were j.p morgans major areas of buisness
tekilochka [14]
John Pierpont Morgan<span> Sr. (April 17, 1837 – March 31, 1913) was an American financier and banker who dominated corporate finance and industrial consolidation in late 19th and early 20th Century United States.</span>
7 0
3 years ago
Biogeochemical system
Dovator [93]

Answer:

gf

Explanation:

bfbfbb

5 0
2 years ago
In a clinical situation where it is essential to control microbial growth that includes both mycobacteria and endospores, which
bija089 [108]
In a clinical situation where it is essential to control microbial growth that includes both mycobacteria and endospores, the chemical <span>agent that would be the most effective to guarantee the broadest disinfection are chlorines.
Chlorine 
(Cl) is a yellow-green gas often used for disinfection in its liquid form. </span>
5 0
3 years ago
Other questions:
  • Horses can be cremello (light cream), chestnut (brown), or palomino (gold with white manes and tails). Oddly, breeders have been
    14·1 answer
  • The human infant spends about half of its sleep time in rem. What is the understanding of why this is the case?
    13·1 answer
  • If a person is in front of a smooth surface from which a sound is reflected, the person would hear a sound that
    15·1 answer
  • Multiple anterior rootlets arise from the spinal cord and merge to form a single ____________ root, which contains ____________
    10·1 answer
  • List three possible places where primary succession might take place
    8·1 answer
  • Pls help, it's overdue!!!! u can gues!!
    10·2 answers
  • 7.Cells of a particular organism are dying at an incredible rate. Under a microscope, doctors are able to determine that the cel
    13·1 answer
  • Conclude Assess what kinds of traits make invertebrate such a diverse group of animals.
    5·1 answer
  • A relationship between two species in which both species benefit.
    8·1 answer
  • Classification of mycelium​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!