1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler [38]
1 year ago
12

tiana has had a long hard day at work. after a 12 hour shift of being on her feet, she just wants to soak her feet and go to bed

. before sticking her legs into the tub, she touches the water with her hand to gauge the temperature. trace the pathway involved in transmitting the sensation of heat from her right hand to the cerebral cortex. make sure to include what type of nerve ending would be involved as well as what area(s) of the brain will the information be transmitted to?
Biology
1 answer:
Crank1 year ago
8 0

Tiana has had a long hard day at work. after a 12-hour shift of being on her feet, she just wants to soak her feet and go to bed. before sticking her legs into the tub, she touches the water with her hand to gauge the temperature. The pathway involved in transmitting the sensation of heat from her right hand to the cerebral cortex is Somato sensory pathway.

  • The cerebral cortex is the outermost layer of the brain and is responsible for the higher-level process of language, memory, reasoning, and thought.
  • It is mainly divided into primary, secondary, tertiary and receives the sensory inputs from the body parts.

Hence from the above points, we can conclude that the pathway involved in transmitting the sensation of heat from her right hand to the cerebral cortex is Somato sensory pathway.

Learn more about the Cerebral cortex:

brainly.com/question/27524635

#SPJ4

You might be interested in
Elaborar 2 ejemplos en oraciones con la caracteristica: Estan formado por celulas
Ray Of Light [21]

Answer:

Existen células sin núcleo?, ¿Qué característica importante debieron adquirir las células que constituyeron los primeros seres vivos pluricelulares?

Explanation:

6 0
2 years ago
If you have a 200kg man and a 50 kg little girl standing at the top of a diving platform that is 8 ft. above a pool. Which perso
rjkz [21]

Answer:

The 200kg man would have more potential energy.

Explanation:

because of his mass compared to the 50 kg little girl.

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
which two cell parts are most likely found in both types of cell? a.cell wall and cell membrane b.lysosome and vacuole c.vacuole
Ainat [17]
Cell wall because their has to be something protecting it.
7 0
3 years ago
What is one change that would cause more water to evaporate from a stream?
Svetllana [295]

Evaporation

Explanation:

Evaporation is one change that would cause more water to evaporate from a stream.

Evaporation is a phase change in which liquid is changed into its gaseous form.

  • When a substance is heated from solid to liquid, it melts.
  • After melting, additional heat causes a phase change that allows for the liquid to change to gases.
  • In the water cycle, the sun provides heat energy that causes surface water in streams to be heated.
  • This leads to evaporation of the surface water into the atmosphere where they can be condensed to form precipitation.

Learn more:

Phase change brainly.com/question/10972073

#learnwithBrainly

4 0
3 years ago
Other questions:
  • What state is farthest north in the Chesapeake bay watershed
    12·1 answer
  • Rotation of a planet causes?
    12·2 answers
  • 3. chemical compound plants make out of sugars into fibers for structure<br> and support
    9·1 answer
  • Which line from Chaucer’s “General Prologue" to The Canterbury Tales is a reference to the feudal social structure of medieval E
    12·1 answer
  • What is the purpose ( goal ) of getting vaccine?
    5·2 answers
  • Mass extinctions have occurred five times in Earth's history. The Permian and Cretaceous extinctions removed a large percentage
    15·1 answer
  • Las bacterias están presentes en todos los alimentos ¿Qué ocurrirá con su metabolismo si refrigeramos o congelamos el alimento?
    8·1 answer
  • Which best describes the Earth’s inner core? A.hot and solid B.hot and liquid C.cool and solid D.cool and liquid
    14·2 answers
  • Im not sure which is the answer
    15·1 answer
  • .Explain how the Mid-Atlantic Ridge was formed
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!