1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Black_prince [1.1K]
2 years ago
13

The change in organisms over geologic history is known as the _____. group of answer choices evolution of life biogeochemical cy

cle evolutionary cycle biospheric change
Biology
1 answer:
LenKa [72]2 years ago
5 0

The change in organisms over geologic history is known as the evolution of life.

<h3>What is evolution of life?</h3>

A biological population's heritable traits change over successive generations, and this process is called evolution. At every level of biological organisation, evolutionary processes give rise to diversity. The last universal ancestor is a term used to describe the common ancestor of all life on Earth.

Modern living things are a direct descendant of extinct ancient life forms, according to evolution, which explains how living things are changing today. The majority of the time, living things improve their environmental suitability as they develop. Due to their ability to adapt, they do this.

We can solve biological issues that have a direct impact on our lives by comprehending evolution. In the world of medicine, there are many fantastic examples of this. Researchers need to be aware of the evolutionary trends of disease-causing organisms in order to stay one step ahead of pathogenic diseases.

To learn more about evolution of life visit:

brainly.com/question/17842856

#SPJ4

You might be interested in
Question 3 (True/False Worth 2 points)
klasskru [66]
The answer is False. Sorry if I answered too late.
6 0
3 years ago
Which of the following would be unlikely to contribute to the substrate specificity of an enzyme
frozen [14]

Answer:

Actually, the enzyme has an allostric regulatory site.  The allostric site is distinct from the active site,  and does not affect the substrate  specificity of the enzyme

Explanation:

5 0
3 years ago
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
torisob [31]

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

5 0
2 years ago
In which kingdom are an overwhelming majority of its individuals producers?
Sladkaya [172]
The majority of the kingdom Plantae are producers:)
6 0
4 years ago
Read 2 more answers
Which of the following statements is FALSE? A. The assisting party in a mutual aid agreement can withdraw deployed resources due
denis23 [38]

Answer:

The correct answer is option C. "Self-dispatch is encouraged in mutual aid systems".

Explanation:

It is false to affirm that self-dispatch is encouraged in mutual aid systems. Mutual aid systems are agreements that let resources assistance across jurisdictional boundaries under emergency situations. Therefore, self-dispatch is not encouraged in mutual aid systems. On the contrary, it is encouraged that the resources request for assistance of other jurisdictions under an emergency situation.  

4 0
4 years ago
Other questions:
  • Which of the following is an example of sustainability?
    8·1 answer
  • What are two products of alcoholic fermentation by yeast of pyruvate?
    13·1 answer
  • 1. Hot coffee is stirred with a spoon, the spoon gets hot due to _______________. 2. A chair is placed several feet from a fire
    14·2 answers
  • Epidermal dendritic (langerhans) cells function as part of the ______ response.
    12·1 answer
  • 5. It is always appropriate to dispose chemicals by flushing them down the sink ?Explain why
    14·2 answers
  • Match the terms to their definition. 1.adaptability 2.growth 3.homeostasis 4.metabolism 5.mitosis 6.reproduction 
    6·1 answer
  • Ok so there's a lot i'm gonna ask. but please help lol.
    13·1 answer
  • Two populations with different environments and different selection pressures are likely to experience which of the following?
    11·1 answer
  • Atoms Bond to each other in order to become__________. *
    7·2 answers
  • What are some ways to deal with the population of lion fish in the Atlantic Ocean?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!