1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
coldgirl [10]
2 years ago
15

What are some ways to deal with the population of lion fish in the Atlantic Ocean?

Biology
1 answer:
Evgesh-ka [11]2 years ago
3 0

Answer:

Hunt them and have divers find them.

Explanation:

Joining a lionfish derby can help control the population in a particular area or dive site. Doing things such as ordering lionfish on the menu when you are going out for lunch or dinner can also be a large help as it creates the incentive and economic reason for more divers to catch more of this particular species.

You might be interested in
A. low mortality
anzhelika [568]
A is right yeah I’m smart wo wo
7 0
2 years ago
Read 2 more answers
The ability of the human body to break down the red color in beets is controlled by an autosomal dominant allele. The inability
Zinaida [17]

Answer:

Explanation:

<em>Let the ability to break down the red color in beets be represented by the allele </em><em>B</em><em>. The inability would be represented by the allele </em><em>b</em><em>.</em>

A nonsecretor's genotype would be BB or Bb while a secretor's genotype would be bb.

A nonsecretor woman with a secretor father would be a carrier with genotype Bb. A nonsecretor man who in a previous marriage had a secretor daughter would also be a carrier with genotype Bb. If the two marries:

            <em>Bb     x     Bb</em>

<em>            BB    2Bb    bb</em>

1.

(a) probability of their first child will be a secretor girl = probability of having a girl and being a secretor.

Probability of having a girl = 1/2

Probability of being a secretor = 1/4

<em>probability of their first child will be a secretor girl</em> = 1/2 x 1/4 = 1/8

(b) Probability of their first child being a nonsecretor girl = probability of having a girl and being a nonsecretor.

Probability of having a girl = 1/2

Probability of being a nonsecretor = 3/4

<em>Probability of their first child being a nonsecretor girl = probability of having a girl and being a nonsecretor</em> = 1/2 x 3/4 = 3/8

2. <em>Probability that their first two children will be nonsecretors of either sex = probability of their first being a nonsecretor and of either sex and probability of their second being a nonsecretor and of either sex.</em>

  = 3/4 x 3/4 = 9/16

6 0
3 years ago
Gene mapping for beak color and feather length in biology what is this
just olya [345]
I am not entirely sure about this. So maybe my response can help you find the answer a little better if my answer is not entirely right?

These last three questions are referring to everything you just worked on. So all you would have to do is refer back to your previous answers. Recall that the titles of the "part 1, 2, and 3" are titled "crossing beak color and tail-feather length", "crossing beak color and feather color", and "mapping tail-feather length and feather color".

1.List the distances between each pair of genes:
beak color and tail-feather length: 20 MU
beak color and feather color: 16 MU
tail-feather length and feather color: 4 MU

2.Which two alleles are the farthest apart?
(the one that is 20 MU apart) Y and L

3.Which two alleles are the closest together?
(the ones that are 4 MU apart) L and B
7 0
2 years ago
The thyroid is an endocrine gland that regulates metabolic function through the production of all of the following hormones exce
Anuta_ua [19.1K]

The thyroid is an endocrine gland that regulates metabolic function through the production of all of the following hormones except: Thyroliberin.

Thyrotropin is a peptide secreted by the anterior pituitary gland that prompts the thyroid gland to release thyroxine. It is also known as thyroliberin and thyroid-stimulating hormone (TSH) Thyrotropin-releasing factor, a peptide located in the hypothalamus of the brain and affecting glandula thyroidea secretion, acts to cause the release of TSH.

In vivo, thyrotropin controls thyroid development favourably. The gland becomes hypoplastic in its absence, either as a result of a pituitary disorder or as a side effect of thyroid hormone therapy, with a reduction in the quantity and size of thyrocytes.

To learn more about Thyrotropin click here

brainly.com/question/28170978

#SPJ4

8 0
1 year ago
Which of the following processes releases energy to be used by a cell? (4 points) Group of answer choices A phosphate group is a
Tanzania [10]

Answer:

D

Explanation:

A phosphate group is removed from ATP to form ADP

3 0
2 years ago
Other questions:
  • Why is the Golgi apparatus in the cell?
    7·1 answer
  • What kind of cell will you find in a leaf of a tree that you wouldnt find in a fingernail
    13·1 answer
  • What are decomposers?
    9·2 answers
  • Which of these polymers is responsible for your inheritance?
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What must be added to the plate before examination of amylase production?
    13·1 answer
  • A 2-kg bowling ball sits on top of a building that is 40 meters tall.
    8·1 answer
  • A 0.2 M solution of NaCl contains ________ g of NaCl in 1 l of ________.
    6·1 answer
  • Which of the following is NOT a function of lipids?
    7·2 answers
  • Sun, Moon, Earth Unit Test
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!