1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
1 year ago
15

There are plants growing in the water. Observation Inference

Biology
1 answer:
NemiM [27]1 year ago
8 0

Please be informed that plants which are adapted to grow in water are known as <u>aquatic</u> <u>plants</u> eg: lotus and hydrilla

However, the observable characteristics of plants which grow on water are:

  • Deeply dissected and waxy leaves
  • Specialized pollination mechanism variation in growth pattern.

<h3>What are living organisms?</h3>

Living organisms; be it plants or animals are any organic or living system which is composed of cells and function as an individual entity.

  • Generally, all living organisms share a number of key characteristics or functions such as movement, respiration, homeostasis, reproduction, growth, evolution, competition and others.

  • Animals and plants also posesses systems such as the digestive, skeletal, transport, nervous, excretory, respiratory and reproductive system.

  • Living organisms are also taxonomically classified as either unicellular microorganisms or multicellular plants and animals

So therefore, please be informed that plants which are adapted to grow in water are known as aquatic plants eg: lotus and hydrilla

Learn more about living organisms:

brainly.com/question/17259533

#SPJ1

You might be interested in
Summarize dosage compensation and it's effects.<br><br> no links please.
AlladinOne [14]

Answer:

'Dosage' of a chromosome (or a gene) refers to its genomic ... The effect of the dosage compensation complex on the X ...

5 0
3 years ago
Whats the carrying capacity?
r-ruslan [8.4K]

Answer:

2003-25

Explanation:

To find carrying capacity on a graph, you need to locate the point on the graph where the population line is horizontal. Alternatively, the carrying capacity may be explicitly marked with a dotted horizontal line or a horizontal line of a different color.

7 0
3 years ago
Why do plants need nitrogen?
stich3 [128]
To make amino acids which makes proteins
3 0
3 years ago
What does the picture show about evolution
Zina [86]
F is the correct answer I think
8 0
3 years ago
Write down the tRNA anti-codons that pair with the mRNA strand.
fredd [130]

Answer:

tRNA molecules bring a specific amino acid to the ribosome, according to the mRNA codon.

Explanation:

In the context of protein synthesis, an mRNA molecule contains the specific codons that encode the amino acids that will be part of the protein. The tRNA is in charge of bringing the amino acids to the ribosome, according to the specific information of the mRNA codons.

8 0
2 years ago
Other questions:
  • Q4.10. Marathon runners can lose a great deal of Na* (through sweat). Some runners
    15·1 answer
  • Complex chemical catalysts produced by living cells are enzymes.
    10·1 answer
  • Nonliving part of the environment is
    7·2 answers
  • Cells go through mitosis to
    5·1 answer
  • Being able to perform well in a high pressure situation is a natural stress response that releases extra hormones.
    13·2 answers
  • Select all that apply.
    14·2 answers
  • Help plzzzzzz I need helppp
    14·1 answer
  • What are the processes in cellular respiration? ( middle school level)
    8·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • In Central and Northern California, the Red-legged Frog (Rana aurora) breeds from January to March. The closely related Yellow-l
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!