1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arturiano [62]
2 years ago
7

Help pls

Biology
1 answer:
Ilya [14]2 years ago
7 0

Answer: The Independent Variable

Explanation:

A good way to remember is the I in Independent. <em>I can change this, I control this</em>

(Ex. Different rose bushes are grown in a greenhouse for 2 months. The number of roses on each bush is recorded at the end of the experiment.

  • Independent Variable - Type of roses
  • Dependent Variable - # of flowers
  • Controlled Variable - Most natural/common rose bush)
You might be interested in
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
What are the two main reasons of pollutants, on the basis of their decomposition?
Luden [163]
They are biodegradable and non biodegradable <span />
3 0
4 years ago
20 POINTS!
IgorC [24]
It is the motion activation part of the brain, if that makes any sense.
3 0
3 years ago
Which statements describe the movement of blood through the heart? Check all that apply. 
vlada-n [284]

Answer:

The correct answer would be Atria push blood into the ventricles and Ventricles push blood out of the heart.

In humans, four chambered heart is present with two atria and two ventricles.

Deoxygenated blood from all over the body is passed into the right atrium through vena cava (superior and inferior).

Simultaneously, oxygenated blood from the lungs is passed into the left atrium of the heart with the help of pulmonary vein.

Both the atria contract at the same time to drain their blood into respective ventricles.

The ventricles undergo relaxation while receiving blood.

The valves present between the atria and ventricles (tricuspid and bicuspid valve) ensures that the blood flows in one way direction only. They shut down as the ventricles contract and produce the sound "lub".

The ventricles contract simultaneously to pump blood out of the heart. The right ventricle pumps deoxygenated blood into pulmonary artery which takes the blood to the lungs for oxygenation.

The left ventricle passes the oxygenated blood through aorta to all the parts of the body.

The pulmonary and aortic valves prevent the back flow of blood and shut at the same time which creates second sound called as "dub".

8 0
3 years ago
Read 2 more answers
These are nucleotides that have a single ring structure. Example: Cytosine, Thymine, and Uracil
IgorLugansk [536]

Answer:

The question is incomplete.

However, I notice that your question is mainly dealing with

"Nucleotides with a single ring structure"

I tackled that part, also providing explanation to the point you focused on.

Explanation:

Nucleotides are compounds in which nitrogenous bases (purines and pyrimidines) are conjugated to the pentose sugars (ribose or deoxyribose) and at least one phosphate group. Thus a nucleotide consists of a nitrogenous base, pentose sugar and at least one phosphate group.

Examples of the nitrogenous bases are Adenine, Guanine, Thymine, Uracil and Cytosine. Of all, Thymine, Uracil and Cytosine are with single ring, while Adenine and Guanine are double ring structure.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What type of anthropologist studies people from a perspective that considers how humans have adapted to their environments over
    12·1 answer
  • Quinn is a six-month-old baby girl who was born preterm. she now weighs 13 pounds. click on the link below to access a growth ch
    11·1 answer
  • Does the body produce antibodies against HIV?
    9·1 answer
  • The substrate in the C test tubes is
    10·1 answer
  • The cell cycle is important to the growth of organisms. This is because the cell cycle allows an organism to
    6·2 answers
  • Minerals make up most of the rocks on Earth's surface. What are three changes that can cause minerals
    5·1 answer
  • Stem cells in plants are referred to as?
    8·1 answer
  • since the parasympathetic division causes the heart rate to ____________ and the sympathetic division causes the heart rate to _
    14·1 answer
  • Which statement best describes the process of erosion? It is difficult to tell if erosion has occurred. It is always a slow proc
    14·1 answer
  • 20 POINTS !!!!!!!!!!! QUICK
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!