1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalija [7]
3 years ago
5

A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the

ir corresponding amino acids. Amino Acid DNA Codon(s) Alanine GCT, GCC, GCA, GCG Arginine AGA, AGG, CGT, CGC, CGA, CGG Asparagine AAT, AAC Aspartic Acid GAT, GAC Cysteine TGT, TGC Glutamic Acid GAA, GAG Glutamine CAA, CAG Glycine GGT, GGC, GGA, GGG Histadine CAT, CAC Isoleucine ATT, ATC, ATA Leucine CTT, CTC, CTA, CTG, TTA, TTG Lysine AAA, AAG Methionine (Start) ATG Phenylalanine TTT, TTC Proline CCT, CCC, CCA, CCG Serine TCT, TCC, TCA, TCG, AGT, AGC Threonine ACT, ACC, ACA, ACG Tryptophan TGG Tyrosine TAT, TAC Valine GTT, GTC, GTA, GTG Stop TAA, TAG, TGA Two strands of DNA are identical except for one codon. As a result, they code for slightly different proteins. Based on the information in the table above, which of the following statements could be true? A. One strand contains a CAC codon instead of CTC. B. One strand contains a ACG codon instead of ACA. C. One strand contains a CCC codon instead of CCA. D. One strand contains a CGC codon instead of CGG.
Biology
1 answer:
Finger [1]3 years ago
6 0

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

You might be interested in
What are the selectively bred animals and plants in the 21st century pls answer I have a project
KIM [24]

Answer:

Selective breeding or it's Animal husbendary

Hope its correct :)

- Ayaan707 for help :) -

6 0
3 years ago
An _______________ is a group of organisms and other non-living parts of the environment that lives in an area.
Sonbull [250]

Answer:

ecosystem

Explanation:

5 0
3 years ago
A frog has more offspring than can survive on available resources.
lbvjy [14]
Seems like Overpopulation, since they can not survive on the amount of resources available.
7 0
3 years ago
Read 2 more answers
Why plants are kept in the dark for a week are still able to conduct cellular respiration.?
Lemur [1.5K]
Because it is an Independent reaction where it is not dependant on solar energy
6 0
3 years ago
What is the most important agent of chemical weathering ?
faltersainse [42]
 Chemical Weathering<span> results from chemical reactions between minerals and Water. Water dissolves calcite </span>more<span> readily than it </span>does<span> feldspar, so calcite is considered a chemical reaction with water.


</span>
6 0
3 years ago
Other questions:
  • Explain how the results exclude the possibility that the trait is encoded by a mitochondrial gene.
    5·1 answer
  • Survival of the fittest
    12·1 answer
  • If your scientific investigation is not testable, is it still scientific?? *
    6·1 answer
  • I wanna go do something with my mom.... ideas??
    15·2 answers
  • What are the similarities between <br><br>1. the linneous and modern classification system?
    11·1 answer
  • Jordan's grandmother uses the juice from squeezed lemons to remove stains from his shirt. He hypothesizes that the juice is the
    6·1 answer
  • How might a mutation in the DNA of the Piedmontese bull lead to muscle hypertrophy
    10·1 answer
  • Cual es el mensaje que te transmite el cuento los tres cerditos
    8·1 answer
  • How is a gene related to an allele?
    7·1 answer
  • How does hydrogen peroxide get into cells?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!