1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalija [7]
2 years ago
5

A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the

ir corresponding amino acids. Amino Acid DNA Codon(s) Alanine GCT, GCC, GCA, GCG Arginine AGA, AGG, CGT, CGC, CGA, CGG Asparagine AAT, AAC Aspartic Acid GAT, GAC Cysteine TGT, TGC Glutamic Acid GAA, GAG Glutamine CAA, CAG Glycine GGT, GGC, GGA, GGG Histadine CAT, CAC Isoleucine ATT, ATC, ATA Leucine CTT, CTC, CTA, CTG, TTA, TTG Lysine AAA, AAG Methionine (Start) ATG Phenylalanine TTT, TTC Proline CCT, CCC, CCA, CCG Serine TCT, TCC, TCA, TCG, AGT, AGC Threonine ACT, ACC, ACA, ACG Tryptophan TGG Tyrosine TAT, TAC Valine GTT, GTC, GTA, GTG Stop TAA, TAG, TGA Two strands of DNA are identical except for one codon. As a result, they code for slightly different proteins. Based on the information in the table above, which of the following statements could be true? A. One strand contains a CAC codon instead of CTC. B. One strand contains a ACG codon instead of ACA. C. One strand contains a CCC codon instead of CCA. D. One strand contains a CGC codon instead of CGG.
Biology
1 answer:
Finger [1]2 years ago
6 0

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

You might be interested in
Find the unit rate with the second given unit in the denominator.
Kobotan [32]
First, the unit is words per minute, not the other way round because you're interested in how fast people can type, not how much time passes for every number of words they write or read (that would be minutes per word)

now, we know they do 4200 in 60 minutes. 

we need to divide 4200 by 60- first,\frac{4200}{60} = \frac{420}{6} = \frac{21}{3} =70

so the answer is, 70 words per minute

I think you made a typo in your answer and you meant 4600 instead of 4200 - then the answer is <span>C. 76 2/3 word/min</span>
6 0
3 years ago
What sample is taken from a pregnant person to perform a maternal serum screening test?
adoni [48]

Answer:

A blood sample is taken. I hope this helps! :)

7 0
2 years ago
The patient is scheduled to have an eeg to confirm the presence of a sleep disorder. the patient asks the nurse to describe stag
AysviL [449]
The best response by the nurse is, this is the deepest stage of sleep and without it, you will be tired and depressed. In addition, an electroencephalogram or as called as (EEG) is a noninvasive test that registers electrical configurations in the brain. The examination is used to diagnose circumstances such as confiscations, epilepsy, head damages, faintness, headaches, brain tumors and sleeping disorders. It can also be used to settle brain bereavement.
6 0
3 years ago
Name two methods other than vaccination for controlling viral diseases
zalisa [80]
<span>Vector control and Drug therapy are two other methods for controlling viral diseases. </span>
5 0
2 years ago
There are many, many new moons and full moons that do not result in eclipses. Why is that?
sleet_krkn [62]

Answer:

the sun doesnt align with the earth and moon

7 0
3 years ago
Other questions:
  • what organelle is found in the plant cells. the function of the organelle is to collect solar energy and use this to produce foo
    7·2 answers
  • The fundamental explanation for the cause of cancer is that (2 points)
    5·2 answers
  • What would you expect to see in a blood sample of a person who has drowned in salt water? explain in terms of osmosis?
    12·2 answers
  • How does the number of cells relate to the functioning of the organism
    11·1 answer
  • In the carbon cycle, carbon is found in a. the atmosphere b the soil c. living organisms d. all of the above.​
    8·1 answer
  • Which of the following is the scientific term for an organism that makes its food from inorganic materials?a.autotroph
    12·1 answer
  • 3. Which group of organelles is directly responsible for the production of new
    6·1 answer
  • Which would be the correct answer​
    5·1 answer
  • A stem cell is
    12·2 answers
  • In a signal transduction pathway, fine tuning of the cellular response occurs in several steps. Which of the following best desc
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!