1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalija [7]
3 years ago
5

A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the

ir corresponding amino acids. Amino Acid DNA Codon(s) Alanine GCT, GCC, GCA, GCG Arginine AGA, AGG, CGT, CGC, CGA, CGG Asparagine AAT, AAC Aspartic Acid GAT, GAC Cysteine TGT, TGC Glutamic Acid GAA, GAG Glutamine CAA, CAG Glycine GGT, GGC, GGA, GGG Histadine CAT, CAC Isoleucine ATT, ATC, ATA Leucine CTT, CTC, CTA, CTG, TTA, TTG Lysine AAA, AAG Methionine (Start) ATG Phenylalanine TTT, TTC Proline CCT, CCC, CCA, CCG Serine TCT, TCC, TCA, TCG, AGT, AGC Threonine ACT, ACC, ACA, ACG Tryptophan TGG Tyrosine TAT, TAC Valine GTT, GTC, GTA, GTG Stop TAA, TAG, TGA Two strands of DNA are identical except for one codon. As a result, they code for slightly different proteins. Based on the information in the table above, which of the following statements could be true? A. One strand contains a CAC codon instead of CTC. B. One strand contains a ACG codon instead of ACA. C. One strand contains a CCC codon instead of CCA. D. One strand contains a CGC codon instead of CGG.
Biology
1 answer:
Finger [1]3 years ago
6 0

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

You might be interested in
AG CLASS
babymother [125]

Answer:

No is wrong

Explanation:

8 0
2 years ago
How is silk extracted from cocoons?​
Firlakuza [10]
The process of silk production is known as sericulture. ... Extracting raw silk starts by cultivating the silkworms on mulberry leaves. Once the worms start pupating in their cocoons, these are dissolved in boiling water in order for individual long fibres to be extracted and fed into the spinning reel.
4 0
3 years ago
Why do cells perform mitosis?
Lena [83]
I’m pretty sure it’s B because they need to be able to replace other cells when they die off but its also to maintain a healthy size so if they are growing too much they may need to split
6 0
3 years ago
Read 2 more answers
Which curve shows the course of the reaction in the presence of an enzyme--the black curve or the red curve? Which line represen
nikklg [1K]
I found the attached image on the internet and it really helps complete this exercise.

First question:
In the presence of an enzyme, the course of the reaction is shown by the red curve. The necessary energy to make a reaction occur is less when there is an enzyme to help the reaction happen. Enzymes work as catalysts that act over substrates converting them into different molecules in a much accelerated way then it would happen without the enzyme's help, if it would happen at all.

Second question:
The activation energy is represented by line B. The activation energy is the energy needed to be available for a reaction to happen. If we compare it with line A, which represents the activation energy necessary for a reaction without an enzyme, we can see how much less energy is necessary to dispend when an enzyme is part of the reaction. Line C represents the energy resultant from the reaction.

3 0
3 years ago
What is the purpose of the yolk in an amphibian egg?
lbvjy [14]
The correct answer is that the yolk provides nutrients for the embryo. Hope this helps.
6 0
3 years ago
Other questions:
  • Which type of water is the most dense? A. cold water with high salt content B. warm, salty water C. cold water with low salt con
    9·1 answer
  • Why is it necessary to eliminate absolutely all invasive fire ant colonies to eradicate the invasive population? a. Every colony
    7·2 answers
  • What is meant by the phrase "Genetic Code"?​
    10·2 answers
  • The walls of the small intestine are folded by what?
    9·1 answer
  • Some species of ant "farm" aphids by protecting them from predators. in return, the ants feed on a sugar-rich liquid (called hon
    14·1 answer
  • 1. In which direction do planets orbit the Sun, clockwise or<br> counterclockwise?
    9·2 answers
  • Given these characteristics of life, which of the following objects is considered a living organism
    10·1 answer
  • Calculate the density of a mineral sample that has a mass of 12 grams and volume of 1.23 cm.
    13·2 answers
  • Your teacher gives you this model of transcription. Choose the statement that best describes the role of DNA in transcription
    12·1 answer
  • How is mitosis different from binary fission?​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!