1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalija [7]
3 years ago
5

A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the

ir corresponding amino acids. Amino Acid DNA Codon(s) Alanine GCT, GCC, GCA, GCG Arginine AGA, AGG, CGT, CGC, CGA, CGG Asparagine AAT, AAC Aspartic Acid GAT, GAC Cysteine TGT, TGC Glutamic Acid GAA, GAG Glutamine CAA, CAG Glycine GGT, GGC, GGA, GGG Histadine CAT, CAC Isoleucine ATT, ATC, ATA Leucine CTT, CTC, CTA, CTG, TTA, TTG Lysine AAA, AAG Methionine (Start) ATG Phenylalanine TTT, TTC Proline CCT, CCC, CCA, CCG Serine TCT, TCC, TCA, TCG, AGT, AGC Threonine ACT, ACC, ACA, ACG Tryptophan TGG Tyrosine TAT, TAC Valine GTT, GTC, GTA, GTG Stop TAA, TAG, TGA Two strands of DNA are identical except for one codon. As a result, they code for slightly different proteins. Based on the information in the table above, which of the following statements could be true? A. One strand contains a CAC codon instead of CTC. B. One strand contains a ACG codon instead of ACA. C. One strand contains a CCC codon instead of CCA. D. One strand contains a CGC codon instead of CGG.
Biology
1 answer:
Finger [1]3 years ago
6 0

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

You might be interested in
All of the following are true about the cell membrane except:-It's semi-permeable-It controls what enters and leaves the cell-It
IrinaK [193]

The cell membrane is a lipid bilayer made of amphipathic phospholipids, which is fluid and selectively permeable to ions and organic molecules, given that the inside of the cell membrane is hydrophobic and the outside is hydrophilic.

The physical characteristics of the cell membrane, along with the proteins and other biomolecules embedded in it, control what enters and leaves the cell.

What the cell membrane DOESN'T do, is control the nucleus of the cell.

3 0
1 year ago
a forest fire destroys an area. a small populations of trees and a large population of birds are both affected. what type of lim
erastovalidia [21]
Dependent limiting factor. That’s when nature(floods/fires) disrupt populations like birds and trees.
Independent limiting factors are like diseases.
4 0
3 years ago
Most gaseous pollutants come from a group of chemicals called _____.
DerKrebs [107]
OXIDES is your answerrrrrrr !!!!!!!!
8 0
3 years ago
Read 2 more answers
What is the answer to this question
Zolol [24]

the correct answer is c I believe

8 0
3 years ago
Consider the generalized cladogram of fish. A fossilized fish is found that has jaws but no true bones. Where does this fossil b
vekshin1

Answer:

B

Explanation:

It would not be D because D is the location of a common ancestor, AKA an animal that does not haver jaws or bones. It would not be C because the question states that the fish has jaws, and C does not have jaws since the arrow does not point to that. It would not be A because the question states the fish has "NO TRUE BONES", meaning that there are no bones present. And in A, there is the bones arrow pointing to it, meaning that A has bones since that trait is on the same horizontal line as A. Only leaving us with option B left, since it came from an ancestor with jaws but not from an ancestor with bones. Sorry, I'm not the best with explaining but hopefully that makes sense why it is B, it's like a family tree, you just have to follow it carefully :) I hope that helps

7 0
4 years ago
Other questions:
  • PLZ HELP ASAP!
    12·1 answer
  • In what pattern does the flow of energy in the ecosystem take place?
    9·2 answers
  • What do you do if people know if they are the control group or the experimental group?
    8·1 answer
  • A human body cell is invaded by a new virus that the body has never encountered before. The cell displays the virus's antigens o
    15·2 answers
  • Which organic molecule is responsible for the insulation of internal organs against shock?
    6·1 answer
  • True or false sedimentary rocks can form from metamorphic rock that has been uplifted
    12·2 answers
  • (External fertilization,internal fertilization) is most common among terrestrial animals.
    14·1 answer
  • For those individuals who have an allergic reaction to cats, a company in Los Angeles promises relief. They offer a new line of
    6·2 answers
  • Describe in detail, using academic vocabulary, how the medical conditions Asthma and diabetes can prevent the cells from not get
    9·2 answers
  • A 7th grade teacher asked students to engage in an argument regarding human impact on a national forest ecosystem that was home
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!