Answer: An error during transcription could produce a shorter protein or induce changes in the protein's sequence.
Explanation: Transcription is the process of single-stranded RNA synthesis from a DNA template (gene). During this process, RNA polymerase reads the DNA template and synthetize RNA, keeping the sequence. The RNA sequence will be reading later by ribosomes and protein will be produced. An error in transcription could produce changes in codons that are sequences of 3 nucleotides that determine aminoacids of the protein, and that would change protein folding and inactive it. Another possible result would be that error in transcription produce a premature stop codon that cause a shorter inactive protein.
Answer:
None of the above
Explanation:
<h3>Because as N has the valence of 3 when it reacts with Cl of 1 as valence they will form NCl3</h3>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Cellular respiration is an oxidative metabolism of glucose which takes place in the mitochondria an in the cell. Some things that can go through cellular respiration is oxygen that has foodstuff molecules that divert the chemical energy into substances.
Explanation:
These substances have a life-sustaining activity and discard things such as waste products,carbon dioxide,and water.Organisms that do not depend on oxygen degrade foodstuffs in a process called fermentation. (For longer treatments of various aspects of cellular respiration, see tricarboxylic acid cycle and metabolism.)
