1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serga [27]
1 year ago
15

An immunoglobulin (Ig) molecule, of any class, with regions symbolized as C or V, H or L , has a light chain made up of _______.

A. one C region and one V region B. one H region and one L region C. three H regions and one L region D. two C regions and two V regions
Biology
1 answer:
Nadusha1986 [10]1 year ago
8 0

An immunoglobulin molecule of any class with regions symbolized as C or V, H or L, has a light chain made up of one C region and one V region.

The glycoproteins known as immunoglobulins (Ig), often known as antibodies, are created by plasma cells. A number of immunogens, including bacterial proteins, promote B cells' conversion to plasma cells. These cells, which make proteins, are involved in humoral immune reactions to bacteria, viruses, fungi, parasites, cellular antigens, chemicals, and synthetic compounds. Using a B-cell receptor, the immunogen or antigen adheres to the B cells' cell surface (BCR).

As a result, a signal is generated that directs the activation of transcription factors, leading to the manufacture of highly specific antibodies for the immunogen that initially activated the B cell. Furthermore, one B cell clone produces immunoglobulin (specificity). Two light chains and two heavy chains that alternate in a light-heavy-heavy-light pattern make up antibodies, also known as immunoglobulins. Therefore, choice A is the right response.

Learn more about immunoglobulins here, brainly.com/question/28203010

# SPJ4

You might be interested in
Kepler correctly proposed that the planets orbited the sun in _____ orbits. a. circular c. linear b. elliptical d. spherical Ple
marta [7]

Answer:

Elliptical. Hope this helps!

6 0
3 years ago
Describe the ground substance and fibers in each type of connective tissue
Ray Of Light [21]
Muscle cells extended called nervous muscle fibre tissue unit of muscle fiber
7 0
3 years ago
Please help with this vein diagram
Margarita [4]
Animal body is made of four different types of tissues.

Epithelial Tissue
Muscle Tissue
Connective Tissue
Nerve Tissue

Plant structure is different from the animal skeletal structure. A plant tissue is different from those in animals. Plant tissues are basically divided into two: Meristematic tissue and Permanent tissue.
5 0
3 years ago
During which of the following phases of cellular respiration does substrate-level phosphorylation take place? During which of th
AveGali [126]

Answer:

Substrate-level phosphorylation, which is a process of forming ATP by the physical addition of a phosphate group to ADP can take place in the cytoplasm during glycolysis or inside the mitochondrial matrix during the Krebs cycle.

Explanation:

Substrate-level phosphorylation is a metabolic reaction that results in the formation of ATP or GTP by the direct transfer of a phosphoryl (PO3) group to ADP or GDP from another phosphorylated compound.

3 0
3 years ago
Breathing is required for cellular respiration. Use the reactions for photosynthesis and cellular respiration to explain why bre
Nuetrik [128]

Answer:

your brain needs oxygen to think and your lungs need oxygen to live and keep your body going

Explanation:

i think not for sure tho

5 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • White blood cells protect against ____ and aid in blood clotti g when injuries are substained
    6·2 answers
  • Which is a possible outcome of global warming?
    11·1 answer
  • During a stressful interval, ________. During a stressful interval, ________. the posterior pituitary gland secretes more growth
    15·1 answer
  • Which types of embryos have pharyngeal slits
    11·2 answers
  • A researcher is studying how depression tends to be experienced by people of different ages. The researcher interviews depressed
    10·1 answer
  • Which statements about the modification of chromatin structure in eukaryotes are true? Select all that apply. View Available Hin
    8·2 answers
  • Environmental laws such as the Clean Air and the Clean Water Acts are an
    6·2 answers
  • The decision that would most likely require the use of the decision-making process. A. Deciding on what to wear in the morning b
    9·1 answer
  • All vertebrate embryos have _____ at some point during embryonic development, indicating a common evolutionary ancestor
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!