1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sav [38]
2 years ago
11

Which is a possible outcome of global warming?

Biology
1 answer:
Oxana [17]2 years ago
5 0

Answer:

More frequent and severe weather

Higher temperatures are worsening many types of disasters, including storms, heat waves, floods, and droughts. A warmer climate creates an atmosphere that can collect, retain, and drop more water, changing weather patterns in such a way that wet areas become wetter and dry areas drier.

You might be interested in
Please help me'
bija089 [108]
Controlled burning? I think that's right.
7 0
3 years ago
Read 2 more answers
Biology is included in the study of
RUDIKE [14]
Life and 98% of what you learn is a waste
5 0
2 years ago
Read 2 more answers
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
What are the tough leathery eggs of reptiles and birds called?
rodikova [14]
They are called Amniotic eggs
6 0
3 years ago
How does the location of the nodules relate to the function of the nodule? Explain
Pepsi [2]

Answer:

loser lol

xxx

Explanation:

dumbo

7 0
3 years ago
Read 2 more answers
Other questions:
  • The process of cellular respiration, which converts simple sugars such as glucose into co2 and water, is an example of _________
    5·1 answer
  • Does blood flow through the veins 3.5 times an hour
    12·1 answer
  • What role does the environment play in natural selection
    5·1 answer
  • A subpopulation of plant, isolated from the main population, is found to obey the function below, describing the number of indiv
    11·1 answer
  • Which data from ocean rocks showed seafloor spreading and convinced scientists the theory of plate tectonics was valid? A. densi
    5·2 answers
  • What is one of the contributions made to the development of the microscope by Galileo?
    11·2 answers
  • In 1668 Francesco Redi did a series of experiments on spontaneous generation. He began by putting similar pieces of meat into ei
    13·1 answer
  • Solar radiation travels through the earth's atmosphere and warms the planet's surface. Greenhouse gases like carbon dioxide in t
    13·2 answers
  • Which is the definition of an amino acid?
    10·1 answer
  • What DNA sequence would code for the amino acid methionine?​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!