2 years ago

Which is a possible outcome of global warming?

Biology

1 answer:

Oxana [17]2 years ago

5 0

Answer:

More frequent and severe weather

Higher temperatures are worsening many types of disasters, including storms, heat waves, floods, and droughts. A warmer climate creates an atmosphere that can collect, retain, and drop more water, changing weather patterns in such a way that wet areas become wetter and dry areas drier.

You might be interested in

Please help me'

bija089 [108]

Controlled burning? I think that's right.

7 0

3 years ago

Read 2 more answers

Biology is included in the study of

RUDIKE [14]

Life and 98% of what you learn is a waste

5 0

2 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved