Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer: bacteria
Explanation:
Prokaryotes are living organisms with one cell (unicellular) with no nuclear envelope, and cell organelles lacking membranes. Examples of Prokaryotes include bacteria and cyanobacteria
the answer would be d. a start base triplet
hope this helps:)
1) Chordata=A chordate is an animal of the phylum Chordata. All chordates possess 5 synapomorphies, or primary characteristics, at some point during their larval or adulthood stages that distinguish them from all other taxa
2) Vertebrates=vertebrate, also called Craniata, any animal of the subphylum Vertebrata, the predominant subphylum of the phylum Chordata. The vertebrates are also characterized by a muscular system consisting primarily of bilaterally paired masses and a central nervous system partly enclosed within the backbone.
3)Invertebrates=Invertebrates are animals that neither possess nor develop a vertebral column, derived from the notochord. This includes all animals apart from the chordate subphylum Vertebrata. Familiar examples of invertebrates include arthropods, mollusks, annelid, and cnidarians.
4) Poikilothermic animals=A poikilotherm is an animal whose internal temperature varies considerably. Poikilotherms have to survive and adapt to environmental stress.
5) Homeothermic animals=The term homeothermic refers to the warm-blooded animals which have constant and relatively higher temperature. They are animals which can maintain their internal body temperature. Complete answer: Homeothermic animals are warm-blooded and maintain a constant body temperature, for example birds and mammals.
6) Oviparous= producing young by means of eggs which are hatched after they have been laid by the parent, as in birds.
7)Vivaparous=bringing forth live young which have developed inside the body of the parent
Sorry if it's incorrect
Have a nice day
