1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
1 year ago
13

Addiction is often viewed as a(n) ________ disease that can rewire the sufferer's brain

Biology
1 answer:
Triss [41]1 year ago
8 0

Addiction is often viewed as a chronic disease that can rewire the sufferer's brain.

<h3>Brain :</h3>

It is highly complicated and highly specialized organ of the body.

An adult human brain weighs about 1400gms . in new born babies it is 400gms.

it has a volume of about 1500 c.c.

it is enclosed in a bony case called cranium which protects brain against external injury.

The brain is surrounded by three membranes called meninges. it protects the brain from external shock.

the meninges are outer duramater ,middle arachnoid,and inner piamater.

piamater is a thin, transparent and vascular membrane close to the surface of brain and spinal cord .

At two places the piamater fuses with the thin, dorsal surface of the brain to form choroid plexus.

The space between duramater and arachnoid is the subdural space and the space between arachnoid and piamater is called subarachnoid space.

These spaces surrounding the brain as well as the cavities within the brain are filled with a lymphatic fluid,called cerebrospinal fluid.

Cerebrospinal fluid protects the central nervous system from external shock,helps in exchange of nutrients and waste products between the nervous tissue and blood and maintains a constant pressure in and around the brain.

Learn more about brain here:

brainly.com/question/1247675

#SPJ4

You might be interested in
Which of the following changes in aging skin contribute to increased susceptibility to infections? Select all that apply. decrea
Luba_88 [7]

Answer:

The answer is langerhans cells.

Explanation:

The first option is false. Melanocytes are cells that are responsible for the production of melanin throughout the skin of the body which affects the skin color.

The second option is also false. The Sebaceous glands are located at the end of the hairs on the skin and are responsible for producing oil throughout.

The third option is correct because langerhans cells are responsible for producing antigen throughout the skin and they are a part of the skin's immune system.

I hope this answer helps.

6 0
3 years ago
Read 2 more answers
Construct an explanation to describe the cycling of matter and energy that occurs during photosynthesis.
kirza4 [7]

Answer:

yes,

but I want to find one account,

and it's about India survey,

I have tried a lot,

but I am not getting,

7 0
2 years ago
Which of the following terms refer to the total number of different species, including humans, on Earth or in an area? (Choose a
lorasvet [3.4K]

Answer:

biodiversity

Explanation:

3 0
3 years ago
Describe how scientists and biologists study the world
son4ous [18]

by experimenting the layers of the earth

4 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • Which of the following is a chemical property of water?
    5·1 answer
  • The condition in which there are two complete sets of chromosomes in a cell is referred to as
    13·1 answer
  • How did the carbon, hydrogen and oxygen atoms in glucose and fructose combine to form sucrose? Include in your description which
    10·1 answer
  • Accoriding to the cell theory which best describes cells​
    13·1 answer
  • Where does the overwhelming amount of seismic activity occur on the earth?
    8·1 answer
  • Sedimentary rock is made from sediments that come from other rocks. These sediments form from _____ of the rocks.
    12·2 answers
  • 35. The organ of the lymphatic system is in which T cells complete their
    6·1 answer
  • What does the term "plastic" mean when saying that "the mantle is plastic"?
    7·2 answers
  • Explain why most high pressure air system form at the poles<br>​
    8·1 answer
  • Students were learning about photosynthesis in science class. the teacher asked the class why photosynthesis was important. whic
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!