1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
choli [55]
1 year ago
5

Buffalo's behaviors and characteristics

Biology
1 answer:
frutty [35]1 year ago
5 0

it is the answer of buffalo behaviour

You might be interested in
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
drek231 [11]

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



5 0
3 years ago
You are studying a protein that you call Protein X. There is an aspartic acid at a key position in Protein X which is important
Sonbull [250]
<h2>Answer:</h2>

The same type of amino acid, means acidic amino acid substitution will leads to normal folding.

The amino acid will be glutamic acid.

<h3>Explanation:</h3>
  • Sometimes the amino acids of the same type substitution leads to normal proteins.
  • As the acidic group of aspartic acid is responsible for the folding of the protein .
  • So if the amino acid is substituted by glutamic acid, it will not leads to any abnormal protein folding.
  • Because glutamic acid also has a acidic group which is responsible for folding of protein.


4 0
3 years ago
Why is it difficult to fossilize large animals?
RSB [31]

Answer:

The onerous elements of organisms, like bones, shells, and teeth have a far better likelihood of changing into fossils than do softer elements. One reason for this can be that scavengers typically don't eat these elements. onerous elements conjointly decay additional slowly than soft elements, giving longer for them to be buried.

Explanation:

8 0
2 years ago
ALCOHOL can increase<br><br> Speed<br> Reaction time<br> Headlights<br> Fatigue
babymother [125]
The answer is fatigue
5 0
3 years ago
Read 2 more answers
HELP WORTHA FREE BRAINLY IF RIGHT
zalisa [80]

Answer: The answers seem correct.

1. Active transport - the process in which energy is used to move the particles of a substance against a concentration gradient from a region where they are in lower concentration to a region whey are in higher concentration.

2. The answer chosen for #2 makes sense because energy is usually needed when you putting effort into doing an activity that includes some type of force. That means ions are using energy to be moved against the concentration gradient.

3. Volume makes sense for the last question since the cells are using a space (volume) to move material in and out by diffusion. The other options besides volume are unreasonable.

3 0
3 years ago
Other questions:
  • The heart lies in the thoracic cavity between the lungs in an area called the
    6·1 answer
  • Which subfield of biological anthropology uses the fossil record to examine the anatomy and behavior of our relatives in the pas
    15·1 answer
  • 1. Where is the most energy found in an ATP molecule?
    14·2 answers
  • The production of ammonia in the reaction catalyzed by glutamate
    6·1 answer
  • What happens to the molecules of a substance when heat is added to it ?
    11·1 answer
  • Put these processes of the water cycle in the correct order, starting from the moment the sun transfer its energy
    8·2 answers
  • Which of the following statements is correct about bound ribosomes?
    8·1 answer
  • What are the names of the five scientists who contributed to what we know about the cells
    12·1 answer
  • The volume of a right circular cylinder can be approximated as follows: Volume = ?r2h; where r is the radius of the cylinder and
    14·1 answer
  • Hey guys i need help plz plz help i am giving all my points
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!