1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TiliK225 [7]
2 years ago
13

If the cytoplasm of a cell is at ph 7, and the mitochondrial matrix is at ph 8, this means that.

Biology
1 answer:
natulia [17]2 years ago
5 0

If the cytoplasm of a cell is at ph 7, and the mitochondrial matrix is at ph 8, this means that the concentration of H+ ion is tenfold higher in the cytoplasm than in the mitochondrial matrix.

<h3>What is pH?</h3>

pH means the power of hydrogen and it is a measure of the degree of acidity or alkalinity of a solution.

The pH tells us how acidic or alkaline a solution is. It ranges on a scale of 1 - 14.

  • pH of 1 - 6 indicates acidity
  • pH of 7 indicates neutrality
  • pH of 8 - 14 indicates alkalinity

According to this question, the cytoplasm of a cell is at pH 7, and the mitochondrial matrix is at pH 8. This suggests that the concentration of hydrogen ion (H+) ion is tenfold higher in the cytoplasm than in the mitochondrial matrix.

Learn more about pH at: brainly.com/question/13978769

#SPJ1

You might be interested in
How is the function of an epithelium reflected in its arrangement
Sergio [31]

Answer:

idk

Explanation:

4 0
3 years ago
The bulky shape of fat cells make them ideal for performing which of the following functions of connective tissue?
Hatshy [7]

The bulky shape of fat cells makes them ideal for filling spaces of connective tissue. The fat cells represent a type of connective tissue.

The adipose tissue is a type of connective tissue composed of fat cells known as adipocytes.

These cells (adipocytes) are specialized cells that store fats, which can be produced by the human body or obtained from the diet.

The shape of the adipocytes can be spherical, oval, polyhedral (as part of adipose connective tissue), etc.

Learn more in:

brainly.com/question/12248793

7 0
2 years ago
Explain how water makes its way to the leaves in the tops of the tallest trees against the force of gravity. Name what the climb
mart [117]

Answer: Capillary action occurs because water is sticky, thanks to the forces of cohesion (water molecules like to stay close together) and adhesion (water molecules are attracted and stick to other substances).

It reminds me of naruto

3 0
3 years ago
Spreading centers with high spreading rates, such as those where plates are diverging rapidly, are characterized by a long, gent
DiKsa [7]

Answer and explanation;

Slow spreading rate

Top middle- rift valley  

Top Right- poorly- developed magma chamber

Rapid Speading rate

Top left- Swell

Top Right- Well- Developed magma chamber

Bottom middle- Diverging plates

Explanation;

-Seafloor spreading is a process that occurs at mid-ocean ridges, where new oceanic crust is formed through volcanic activity and then gradually moves away from the ridge.

-This is what happens at the mid-oceanic ridge where a divergent boundary is causing two plates to move away from one another resulting in spreading of the sea floor. As the plates move apart, new material wells up and cools onto the edge of the plates.

7 0
3 years ago
In which layer of the sun does nuclear fusion occur? Explain how the nuclear fusion is created
Aleksandr-060686 [28]

A large cloud of gas (hydrogen) and dust a nebula begins to collapse

The collapsing cloud begins to spin

The spinning collapsing cloud flattens into a rotating disk

Material in the disk begins to accumulate in the center

As the material coalesces in center, it becomes dense, compresses, and heats up.

More and more material coalesces to form a protostar.

The protostar continuse to accomulate material from the surronding disk and grow.

Eventually, the protostar becomes massive enough, dense enough and hot enough to cause the process of  nuclear fusion to begin.

Nuclear Fussion isotops of hydrogen atoms (deuterium, tritium) combine to form helium atoms, energy, and subatomic particles.

Once nuclear fusion begins the protostar's “ignition” to nuclear fusion creates a solar wind that drives remaining gas and dust to the outer parts of the disk.

Then the young star stops accumulating material.

7 0
3 years ago
Other questions:
  • • explain the differences between the x and y chromosomes and how they differ from the rest of human chromosomes.
    6·1 answer
  • The pouch of skin that contains the testes is the
    12·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What is the name of the reaction when you split a disaccharide?
    9·1 answer
  • How do the bones, muscles and sensory organs work together?
    14·1 answer
  • Which cytoskeleton protein helps a cell maintain its shape
    13·1 answer
  • The heat from the Sun must pass through the vacuum of space before it reaches the Earth. Which process is illustrated in this ex
    7·2 answers
  • Hi,Cyclone occur over the oceans of equatorial region why give reason​
    12·2 answers
  • The body protects itself from the cold by dilating the blood vessels and increasing blood flow
    6·1 answer
  • Select the correct answer
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!