1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina1246 [14]
3 years ago
12

Hi,Cyclone occur over the oceans of equatorial region why give reason​

Biology
2 answers:
taurus [48]3 years ago
6 0

Answer:

Cyclones are actually water born storms in the equatorial regions.

Mainly, water near this equator get heated up as it receives direct sunlight, the hot air rises up and to fill this empty space cold air from poles rush to these equatorial regions. And hence the cyclones are mostly formed in Equatorial regions.

uranmaximum [27]3 years ago
3 0

Answer:

Tropical cyclones are enormous engines that run on warm, wet air. That's why they only develop around the equator, in warm ocean waters. The warm, wet air at the surface of the ocean rises upward. There is less air at the surface because this air is moving up and away from it.

<u>OAmalOHopeO</u>

You might be interested in
9. PLEASE HELP A LOT OF POINTS
MissTica

Answer:

im pretty sure its D

Explanation:

sorry if im wrong

8 0
4 years ago
The bottom one is...
Ann [662]

AARP. Which legitimately American Association of Retired Persons . Which honestly speaks for itself. This groups has stood for 10 years and helps many today.


5 0
3 years ago
Two species of tree frogs occupy different elevations in the canopy of a rain forest. If these frogs with strikingly different p
shtirl [24]

Answer:

Habitat Isolation

Explanation:

Ecological, or habitat, isolation occurs when two species that could interbreed do not because the species live in different areas.

8 0
4 years ago
High-throughput sequencing reveals that 30 new mutations have occurred in the coding regions of genes in an individual lizard. I
dybincka [34]

Answer:

100 per million

Explanation:

4 0
3 years ago
Which of the following scenarios is most likely to occur if the climate continues on its current trajectory? a. Continental glac
pychu [463]

Answer:

b. Cities like New York, New Orleans, and Miami will be flooded by ocean water.

Explanation:

The theory says global warming will cause the temperature of the planetary atmosphere to rise. The hotter environment will make ice masses of Greenland, and the poles to melt completely and make coastal cities like New York, New Orleans, and Miami flooded by the ocean.

6 0
3 years ago
Other questions:
  • Why don’t recessive traits always eventually disappear from populations?
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which processes would cause an animal cell to burst if it were placed in distilled water
    5·2 answers
  • If an adult dog had 78 chromosomes the number of Chromosomes in a dogs sperm will be
    8·2 answers
  • Cellular respiration, as well as other body processes, produces wastes. These wastes must be eliminated from the body in order f
    14·1 answer
  • 15 meters is how long in a foot?
    13·2 answers
  • Help please! Need help!!
    5·1 answer
  • El agua es una sustancia pura?
    13·1 answer
  • Describe the PCR technique; include details about the components required in a PCR reaction and the stages of each cycle. Make s
    10·1 answer
  • Question: Organelles are specialized structures that perform various functions in the cell. What are the functions of the organe
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!