Answer:
It is measured in Joule
Explanation:
Energy Units and Conversions. 1 Joule (J) is the MKS unit of energy, equal to the force of one Newton acting through one meter. 1 Watt is the power from a current of 1 Ampere flowing through 1 Volt. 1 kilowatt-hour is the energy of one kilowatt power flowing for one hour.
I hope this helps! Please mark me brainliest!
old useful paper that someone threw in the trash
Answer:
The answers to the blank spaces are numbered as follows:
1. Function
2. Nucleus
3. Mitochondria
4. ATP
5. Chloroplast
6. Glucose
7. Ribosomes
Explanation:
This question is describing the organelles found in a cell. An organelle is a structure that performs a specific FUNCTION (1) in a cell. There are different kinds of organelles with each possessing its own peculiar function. Some of them are as follows:
- NUCLEUS, which is regarded as the brain of a cell because it directs or controls a cell's activities just like the brain of an organism does.
- MITOCHONDRIA is an organelle that produces the energy storing compound called ATP (adenosine triphosphate), hence, it is called power house of the cell.
- CHLOROPLAST is an organelle found in plant cells that functions in the conversion of light energy (from sun) into GLUCOSE (chemical energy) in a process called PHOTOSYNTHESIS.
- RIBOSOMES is an organelle found in both prokaryotic and eukaryotic cells that serves as the site of PROTEIN production in a cell.
Answer:
The source of blood carried to capillaries in the myocardium would be the coronary arteries - C.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
