1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blsea [12.9K]
1 year ago
9

phase 1 dose escalation trial of the safety and pharmacokinetics of cabozantinib concurrent with temozolomide and radiation or t

emozolomide post-radiation in newly diagnosed high
Biology
1 answer:
Bess [88]1 year ago
5 0

For patients with newly diagnosed high-grade gliomas , Cabozantinib at a dose of 40 mg daily with RT + TMZ and post-RT TMZ was generally well tolerated.

<h3>How would you define diagnosed?</h3>

The procedure of determining a diagnosis, disease, or injury based on its indications and symptoms. To aid in the diagnosis, testing like blood tests, imaging tests, and biopsies may be done in addition to a physical examination and health history.

<h3>How do doctors make their diagnosed?</h3>

A doctor or other healthcare professional often makes a diagnosis after a physical examination and a thorough review of the patient's medical history. The next step is to prescribe tests and other diagnostic procedures to identify the underlying disease or injury that is causing the symptoms.

To know more about Diagnosed visit:

brainly.com/question/13549533

#SPJ4

You might be interested in
Which organ system includes the bones and cartilages? Which includes the nasal cavity, lungs, and trachea?
Romashka [77]

Answer:

The skeletal system provides the shape and form for our bodies in addition to supporting and protecting our bodies, allowing bodily movement, producing blood cells, and storing minerals. This system consists of bones, cartilage, and joints.

The primary function of the respiratory system is to supply the blood with oxygen in order for the blood to deliver oxygen to all parts of the body. The respiratory system does this through breathing. It consists of the nose, larynx, trachea, diaphragm, bronchi, and lungs.

3 0
3 years ago
Read 2 more answers
In cabbage butterflies, White wings are dominant to yellow wings. Create a Punnett Square that shows the offspring that results
kari74 [83]

Answer:

In cabbage butterflies, White wings are dominant to yellow wings. Create a Punnett Square that shows the offspring that results if a Ww butterfly is crossed with a ww butterfly. Create a Punnett Square. What percentage of the offspring will have yellow wings? and What is the phenotypic ratio (color ratio)?

Ww x ww= Ww, Ww, ww, and ww

50% has yellow wings

The phenotypic ratio is two white wings butterflies and two yellow wing butterflies 2:2 50%:50%

Explanation:

6 0
3 years ago
Describe how you could simulates one of the cases from the computer simulation (Case 2, Case 3, or Case 4) using the basic labor
satela [25.4K]

In place of clicking on the touchpad for the Cases, I would boost in response to the visual incitements that would be linked with a reflex hammer with an accelerometer; the reflex hammer would move appropriately to the carrying of the picture on the screen by a programmed mechanical device. I wouldn’t use the reflex hammer’s sound however; it’s purely there to compute my reaction times (time of highest acceleration of movement of the reflex hammer deducted by time of reflex) instead of using the computer’s software at figuring reaction times, since I think the software is defective.

7 0
3 years ago
What would happen if a quaternary consumer were added to this ecosystem?
Finger [1]

Answer:This lesson introduces and explains the ecological concept of a quaternary consumer. It discusses which organisms act as quaternary consumers and. ... If so, you've filled the role of primary consumer by eating lettuce (a producer). ... In which case it should be easy to understand that quaternary consumers are next in line

Explanation:

5 0
3 years ago
Grazing cows disturb the grass and cause insects to fly around the cows as they eat. In turn, birds swoop in and eat the insects
VashaNatasha [74]
I think this relationship is <span>Commensalism because one of them benefit(the bird) and one is not benefited or harmed(the cow).</span><span />
5 0
3 years ago
Read 2 more answers
Other questions:
  • Why do living things store energy in lipids instead of carbohydrates??
    10·1 answer
  • What part of the nervous system is very well protected by bone? (1 point)
    12·1 answer
  • 11) Whatever its ultimate cause(s), the Cambrian explosion is a prime example of
    12·1 answer
  • Please help!!!
    12·2 answers
  • A postbirth complete blood count (cbc) has noted an elevated white blood cell (wbc) count of 22,000/mm3. which rationale is accu
    9·1 answer
  • The relationship between transcription and translation?
    10·1 answer
  • Marsupial mole rats evolved in New Zealand in the 1700s and had few natural predators so they overpopulated the area. Scientist
    12·1 answer
  • The energy to turn raw materials into food is powered by ________ and occurs in the plant’s ________.
    7·1 answer
  • What is the sequence ? ​
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!