All categories

1 year ago

Give an example of temporal isolation and explain how temporal isolation is preventing reproduction within the population.

1 answer:

3 0

Various cicada species erupt to reproduce at various times. A prime example of temporal isolation is this. The frog species Rana aurora and Rana boylii exhibit temporal isolation as a result of variations in seasonal breeding. Although both species live in the same geographic areas, their mating seasons are different.

<h3>What is temporal isolation ?</h3>

When many species reproduce at various periods, there is a condition known as temporal isolation. Three different orchid species, for instance, coexist in the same rain forest. Every species contains flowers that only bloom for a single day and need to be pollinated on that day in order to generate seeds.

Due to differences in fertility or mating timing, such as having various mating seasons, species cannot interbreed due to temporal isolation. Due to different mating practises or rituals, behavioural isolation prevents species from interbreeding.

Learn more about Temporal isolation here:

brainly.com/question/469933

#SPJ4

You might be interested in

What is the process in which plants use sunlight energy to make glucose?

Mamont248 [21]

Answer: photosynthesis

Explanation: the process in which plants use sunlight energy to make glucose is photosynthesis

8 0

3 years ago

Species with homologous structures most likely:

nikitadnepr [17]

Species with more likely homologous structures share a common ancestor.

D. share a common ancestor.

<h3>What are example homologous structures?</h3>

The most correct definition for homology would be: They are structures of individuals, of different species or not, that were inherited from a common ancestor. The human arm is homologous to the horse's front leg. The bat's wing is homologous to the whale fin.

With this information, we can conclude that homologous have same embryological origin of structures from different organisms, and these structures may or may not have the same function

Learn more about homologous structures in brainly.com/question/7904813

#SPJ1

7 0

2 years ago

Read 2 more answers

Which is a product of<br> photosynthesis?<br> A. chemical energy<br> B. light<br> C. carbon dioxide

ioda

Answer:

carbon dioxide is the product of photosynthesis

4 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

What is the end result and purpose of meiosis?

Sedaia [141]

The answer is 4 gametes that have the number of chromosomes....

5 0

3 years ago