1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yanalaym [24]
3 years ago
10

Meiosis is important for sexual reproduction because it gives sex cells (gametes) what unique feature?

Biology
1 answer:
sleet_krkn [62]3 years ago
4 0
One set of chromosomes. haploid
You might be interested in
How are human activities contributing to the rise in Earth’s temperatures?? Someone answers fast please!
Reika [66]

Pollution plays a huge factor. With factories in demand, more and more substances are being released into Earth's atmosphere, resulting in higher temperatures.

6 0
3 years ago
SOMEONE PLEASE HELP ME WITH THIS !!!
Liono4ka [1.6K]

Answer:

D

Explanation:

It is often like this: cell->tissue->organ->system

3 0
3 years ago
After a natural disaster such as a hurricane or tornado, what will happen in the damaged ecosystem?
Lyrx [107]

Answer:

C

Explanation:

C. It's right.

8 0
3 years ago
What is a distinguishing characteristic of primary succession?
gavmur [86]

Answer:

primary succession only occurs on bare rock

Explanation:

8 0
3 years ago
A high school biology teacher asks her students to collect daily rainfall amounts at each of their homes during the summer. The
Alex777 [14]
Below are the choices:

<span>a. creating an online chat group for asking questions and posting solutions
b. establishing a standard method for delivering the results to the teacher
c. offering a wide variety of rain gauges for everyone to choose from
d. using a standard unit of measure for the duration of the study
</span>
the answer is D. I hope it helps. 
5 0
3 years ago
Read 2 more answers
Other questions:
  • consider their functional differences why do you think the walls of arteries are proportionately thicker than those of the corre
    14·1 answer
  • Describe the helical and coiled-coil structures of either collagen or α-keratin. What type of covalent bond holds the coiled-co
    15·1 answer
  • Classify the energy sources as renewable or non renewable
    15·1 answer
  • What is the catalyst in a metabolic pathway
    15·1 answer
  • Explain how carboxyhaemoglobin leads to death<br>​
    15·1 answer
  • The allele for red hair is recessive to the allele for black hair. What colour hair will a person have if he inherits an allele
    15·1 answer
  • A sleepy driver rounds a bend and sees a deer standing in the road. The driver snaps to attention and applies the brakes, averti
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Is a carbohydrate that makes up the cell walls of plants
    15·1 answer
  • Discuss the importance of the following characteristics of living organisms​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!