1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mafiozo [28]
10 months ago
6

!!!!!!!!!URGENT!!!!!!!!!!What Taxa class would this fossil belong to? Explain why.

Biology
1 answer:
pishuonlain [190]10 months ago
8 0

The taxa under which the given plant fossil come is angiosperm.

<h3>What are taxa?</h3>

Taxa refer to any unit employed in the discipline of biological classification, often known as taxonomy. Taxa are organized in a hierarchical order, from kingdom to subspecies, with a particular taxon typically containing numerous taxa of lower rank.

Taxa are given formal names after being properly identified by nomenclature codes and systems. Bryophyta, Pteridophyta, Gymnosperms, and Angiosperms are a few examples of major plant taxa.

Therefore, the taxonomic group from which the presented plant fossil is derived is angiosperm.

To learn more about taxa, refer to the link:

brainly.com/question/23028263

#SPJ1

You might be interested in
Which of these processes as a cooling affect on earth? (APEX)
scoundrel [369]

Answer:

The answer is A. Evaporation of water due to warmer temperature causes low thick clouds.

Explanation:

Evaporation is the process in which liquid is changed into gas due to increases temperature or pressure. It is an important part of water recycling in nature. water from sea, rivers and streams evaporate and form clouds which brings water back to earth by raining. Evaporation also causes cooling effect as during evaporation heat is absorbed from the environment. On the other hand the cloud formation and rain also induce cooling by bringing down the temperature.

3 0
2 years ago
Many biologists debate how a virus should be classified. In 2008, scientists in France discovered that a virus was capable of in
expeople1 [14]

Answer: any virus should be classified by or what it is

Explanation:

4 0
3 years ago
If you were to look at a mass of cells under the microscope in which part of the cell cycle would you expect to find most of the
OLga [1]

Answer:

A?

I think I'm wrong! please tell me what one it is if I'm wrong.

4 0
2 years ago
Read 2 more answers
22 (101 HC) Why have none of the competing hypotheses about the origin of life on Earth been developed into a scientific theory?
Margaret [11]
Because you cannot test it or observe it.

A scientific theory are created through the scientific method, in the scientific method you need to be able observe it and experiment. 
5 0
3 years ago
Which description is an example of codominance
xxMikexx [17]

Answer:

Explanation:

Codominance means that neither allele can mask the expression of the other allele. An example in humans would be the ABO blood group, where alleles A and alleles B are both expressed. So if an individual inherits allele A from their mother and allele B from their father, they have blood type AB.

3 0
2 years ago
Other questions:
  • In response to a stimulus such as touch, a human neuron sends a signal to the brain using
    15·1 answer
  • BRAINLIEST ANSWER!!!!!!!!
    8·1 answer
  • The phase of mitosis that is characterized by the arrangement of all chromosomes alone the equator is called
    8·2 answers
  • Which of these is a hypothesis?
    5·1 answer
  • A is a group of atoms that behave like they are one ion​
    14·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Explain how evolution accounts for diversity of living things
    11·2 answers
  • Often organisms seem similar in their outward appearances. For example, a porpoise and a shark seem closely related, but they ar
    9·1 answer
  • What is a strength in the figure?
    10·2 answers
  • PLEASE HELP 100 POINTS URGENT
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!