1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
1 year ago
12

A tropic hormone targets and stimulates an endocrine organ or gland to release another

Biology
1 answer:
Ede4ka [16]1 year ago
8 0
Only answer A, B, and C
You might be interested in
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Write 2 sentence of what will happen to a plant without water
vladimir1956 [14]

they would die.... the two main things a plant need is water for the turgor to keep the upright and make sure it doesnt wilt and of course for photosynthesis

5 0
2 years ago
Which is a component of a phospholipid
hichkok12 [17]

Answer:

Phospholipids consist of a glycerol molecule, two fatty acids, and a phosphate group that is modified by an alcohol.

Explanation:

these are the key points of the phospholipids

hope this helps :)

6 0
3 years ago
If a DNA sequence is TTA, what would be the anticodon the tRNA would bring to the ribosome?
agasfer [191]

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

7 0
2 years ago
Read 2 more answers
Male marine iguanas can reach a length of
Sav [38]
6 Feet.

Hoped this helped!
8 0
2 years ago
Other questions:
  • What are 2 things states can do to prepare for droughts?
    14·1 answer
  • What scientific questions could Claudia ask about the flame? Check all that apply.
    7·2 answers
  • What does this passage most likely reveal about how the characters view the situation?
    6·2 answers
  • When two species compete for the same ecological niche, they cannot coexist because they are competing for the exact same resour
    7·1 answer
  • Deforestation is causing rainforest around the amazon to dry up?<br><br><br> True <br><br><br> False
    11·1 answer
  • Supercoiling is important for DNA structure, because Supercoiling is important for DNA structure, because it provides energy for
    9·1 answer
  • Good observations are not critical to scientific investigations.<br><br> True<br><br> False
    6·1 answer
  • 3. How does the salinity in water change as you move from inland areas out towards the ocean? Be sure to include the phrase "bra
    14·1 answer
  • A gene is a segment of mrna
    12·1 answer
  • 1. Which systems (2) are primarily responsible for movement of the body
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!