Which of the following best describes the purpose of examining mammary secretions in mares before parturition?

1 answer:

3 0

The statement that best describes he purpose of examining mammary secretions in mares before parturition is testing for elevated levels of calcium.

<h3>What is the processes of parturition in mares?</h3>

In parturition, a fetus is fully developed, a process called Ferguson reflex occurs to stimulate contractions. The canal is lubricated by a fluid called allanotic fluid and facilitates the discharge of the amnion and the fetus. A virginal distension releases oxytocin and more contractions.

For a mare to be ready for parturition, elevated levels of calcium is tested from the mammary gland to confirm that the mare is healthy and ready for parturition.

Learn more on parturition here: brainly.com/question/14982881

#SPJ1

You might be interested in

An earthworm's digestive system has a pharynx, crop, gizzard, and intestine true or false?

Hoochie [10]

I think the answer is true

5 0

4 years ago

Help me plz, will give 10 pointzz and a brainliest

vazorg [7]

Answer:

a. (black fur): phenotype

b. (AA, Aa, aa): genotypes

c. (Aa): heterozygous

d. (aa): hom0zygous recessive

e. (AA): hom0zygous dominant

Explanation:

(lol brainly wont let me some of the words)

I took bio and genetics I hope this helps !!!

6 0

3 years ago

This macromolecule is composed of carbon, hydrogen and oxygen but is not a lipid

ratelena [41]

Answer:

If the macromolecule is not lipid, then IT'S CARBOHYDRATE

5 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Energy,growth,evolutionary, and ecological describe different biological

Ray Of Light [21]

The correct answer would be:

<em>Cycles.</em>

6 0

3 years ago

Read 2 more answers