1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juliette [100K]
3 years ago
14

At which stage of meiosis is each chromosome composed of a single chromatid?

Biology
1 answer:
Aneli [31]3 years ago
6 0

Answer:

Anaphase II.

Explanation:

Meiosis may be defined as the process of cell division in which a single diploid cell is divided into the four haploid cells. Two stages of meiosis are meiosis I and meiosis II.

The anaphase II of the meiosis consists leads to the finals stage of meiosis after telophase division. The chromosome at this stage is consists of the single chromatid and is similar as anaphase of the mitosis. The anaphase stage results in the maintenance of the genetic constitution of the cell.

Thus, the correct answer is option (C).

You might be interested in
Needed for bacteria to carry out their life functions
joja [24]

Answer:

cells

Explanation:

cells carry out functions for life

4 0
3 years ago
What enzyme binds fragments of DNA on the lagging<br> strand?
Rainbow [258]

Answer:  <em>Enzyme DNA ligase is the fragments of DNA on the lagging.</em>

8 0
2 years ago
What must be done to breed dogs for a particular trait
Alecsey [184]
Hello there.
Mate 2 dogs that have the desired trait, Any farther questions just ask.
Hope this helps.
6 0
3 years ago
Read 2 more answers
Which describes John datiton observations of elements in any given compound
dmitriy555 [2]

Atoms of different elements always combine in the same way.

John Dalton noted that if the components are added to one exacerbated, the share of their masses will dependably be the same. Dalton's been an English scholar. The component mass of that mix is measured by the confirmation of the presence of molecules assembled by John Dalton.

3 0
3 years ago
What is the similarity between a fjord and a gully? help pls ;-;
VLD [36.1K]

Answer:

They are examples of erosion by water in different forms

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is homeostasis?
    12·1 answer
  • A body of cell that is undergoing abnomal cell division is mostly
    8·1 answer
  • Which sectional planes of the body could show parts of both lungs and the heart?
    15·1 answer
  • What does the carrying capacity describe
    12·1 answer
  • PLEASE HELP ASAP<br> What are the three stop codons? What is the start codon?
    6·1 answer
  • What is a protein that catalyzes chemical reaction for organisms
    10·1 answer
  • The burning of fossil fuels contributes to the addition of greenhouse gasses to the atmosphere. These gases trap thermal energy
    7·1 answer
  • Which type of energy is stored in fuels such as gasoline and batteries?
    7·2 answers
  • Do the virus Chickenpox. I will find a image no need to worry about that.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!