1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rainbow [258]
1 year ago
13

What does the epidermis help the leaf with?

Biology
1 answer:
MArishka [77]1 year ago
8 0

The epidermis is the remotest subcaste of cells generated from the protoderm that covers the stem, root, splint, flower, fruit, and seed sections of a factory. The moldable cuticle of the epidermis acts as a hedge against infection, water loss, and mechanical detriment.

<h3>What about epidermis?</h3>
  • Botanically speaking, the epidermis is the face, single- layered caste of cells that covers a plant, particularly the flake and immature vascular plant corridor like stems and roots.
  • In vascular shops, the dermal napkins are called epidermis and periderm.
  • The barricade separating the plant from the outside world is the epidermis.
  • Pavement cells, guard cells, and the attachment cells that compass the stomata and trichomes, sometimes known as flake hairs, are the three introductory cell types that make up the plant epidermis.
  • Conical cells, a kind of trichome, are also formed in the epidermis of petals.
  • The cuticle, a functional permeability barricade of the cell wall that inhibits devilish water loss and the entry of dangerous agents and pathogens into the host, is formed by the plant epidermis and serves as its primary function.
  • The epidermis is the flake's outermost caste.
  • On either side of the flake, the top and lower epidermis make up this caste.
  • Botanists designate the undermost side as the abaxial face and the upper side as the adaxial face.
  • Gas control is backed by the epidermis.

Learn more about epidermis here:

brainly.com/question/17262095

#SPJ1

You might be interested in
What precautions should be made to be sure that there is little chance of negative consequences from an oil spill?
Feliz [49]

Answer:

hi, here's the answer of your question

Tighten bolts on your engine to prevent oil leaks.

Replace cracked or worn hydraulic lines and fittings before they fail.

Outfit your engine with an oil tray or drip pan.

Create your own bilge sock out of oil absorbent pads to prevent oily water discharge.

hope this was helpful...

<em>pls mark this as the brainliest answer...</em>

7 0
3 years ago
What does the presence of new rock near an oceanic ridge indicate?
Gelneren [198K]

Answer:

A

Explanation:

5 0
3 years ago
Read 2 more answers
If the DNA code for the amino acid alanine is CGA, the tRNA anticodon for alanine is ?
djyliett [7]

Answer:

2

Explanation:

7 0
3 years ago
Read 2 more answers
What makes embryonic stem cells useful for medicine
jeyben [28]
B: <span>They can differentiate into more </span>cells<span> than adult </span>stem cells can.<span>They can differentiate into more </span>cells<span> than adult </span>stem cells<span> can.</span>
6 0
3 years ago
Slight rotation between the femur and tibia is possible due to the action of the ____________ muscle.
LUCKY_DIMON [66]
Popliteus muscle

from: https://en.m.wikipedia.org/wiki/Popliteus_muscle
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following representations shows how one variable changes in response to another variable?
    13·1 answer
  • Why is the Great Garbage Patch known as “Trash Vortex”.
    15·1 answer
  • Viruses are parasitic, in that they require a host cell in order to go through the process of reproduction. When the influenza v
    13·2 answers
  • The water cycle consists of some water evaporating from
    5·1 answer
  • Describe how a vein of silver forms from a solution.
    6·1 answer
  • Is a gene that can be masked by dominant gene
    11·2 answers
  • Explain two ways your life was affected by bacteria today
    13·1 answer
  • In cold and wet cliamates how does that effect weathering?
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • In order to call a cardiac rhythm paroxysmal supraventricular tachycardia you would have to:___.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!