1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cupoosta [38]
1 year ago
13

okazaki fragments select one: a. elongate the lagging strand away from replication fork 5' --> 3' b. elongate the leading str

and toward replication fork 5' --> 3' c. elongate both strands, but do the lagging strand more slowly d. elongate the lagging strand toward the replication fork 5' --> 3'
Biology
1 answer:
diamong [38]1 year ago
8 0

The Okazaki fragment moves the lagging strand away from the replication fork 5' --> 3'.

<h3>What does Okazaki Fragment do?</h3>
  • Okazaki fragments are small stretches of DNA formed during discontinuous lagging strand synthesis during DNA replication. They are important because they allow the synthesis of both daughter strands required for cell division.
  • DNA polymerases are enzymes involved in DNA replication. It synthesizes DNA only in the 5'-3' direction. However, double-stranded DNA is antiparallel, so DNA synthesis should occur in both directions. Thus, Okazaki fragments are formed during synthesis of the lagging template strand.
<h3>What is difference between leading and lagging strands?</h3>

The main difference between leading and lagging strands is that the leading strand is the DNA strand that grows continuously during DNA replication whereas the lagging strand grows discontinuously by forming short segments known as Okazaki fragments.

To learn more about okazaki fragments visit:

brainly.com/question/29428237

#SPJ4

You might be interested in
Which of the following would most likely result in the greatest decrease in the rate of a chemical reaction ?
g100num [7]
<span>Most likely result in the greatest decrease in the rate of a chemical reaction would come from the correct posting of all your answer choices available</span>
5 0
3 years ago
10.
Scorpion4ik [409]

Answer:

1. Iodine

Explanation:

6 0
2 years ago
24 POINTS!!!!!!
Crazy boy [7]
V final = (Mass x V initial) + (Mass x V initial) /m + m
V = (0.04 x 300) + ( 0.5 x 0 ) / 0.04 + 0.5
V = 22.2 m/s
6 0
3 years ago
What fermentation takes place in animals
prisoha [69]
Lactic acid fermentation
3 0
3 years ago
Read 2 more answers
The nursing instructor is teaching the students about degenerative diseases that affect both the musculoskeletal and neurologic
Gelneren [198K]

Answer:

Alzheimer's disease

Explanation:

Neurodegenerative disease is the condition which is caused when the fundamental unit of the nervous system called neurons degenerate.  The two main neurodegenerative diseases are Alzheimer's disease and Parkinson's disease.

The Parkinson's disease is the disease which affects the musculoskeletal system but the Alzheimer's patient is not able to recall the memory and events, therefore, interfere with the deterioration of the cognitive and emotional abilities.

Thus, Alzheimer's is the correct answer.

7 0
3 years ago
Other questions:
  • Why is it important to have the International System of Units
    9·2 answers
  • In class switching in the secondary antibody response, the most common antibody switch is from
    13·1 answer
  • . Determine the sequence of bases in mRNA if the original DNA base sequence is TAGGCTAA
    6·1 answer
  • A cancer, acute lymphoblastic leukemia, is caused by chromosomal translocation. How does this condition arise
    13·1 answer
  • You modify the gene for an integral membrane protein so that the cytoplasmic portions of the protein are deleted. when the gene
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Fish most commonly live ________. in the upper part of the oceans in the thermoclines far from islands and continents near islan
    9·1 answer
  • What does Glycolysis and ETC take in (whats their input) and take out (whats their output)?
    13·1 answer
  • Native farmers in a small town are clearing massive areas of trees to plant crops. This is an example of
    15·2 answers
  • For an organism to be classified in the animal kingdom, which characteristics must the organism have?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!