1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sdas [7]
1 year ago
7

why was it important that mendel saw 3:1 ratios for multiple traits as opposed to only seeing it for flower color?

Biology
1 answer:
ololo11 [35]1 year ago
8 0

There is an emphasis on 3:1 ratios when learning genetics because they represent an important case by illustrating the impact of dominant-recessive relationships between alleles on mating outcomes.

The F2 generation produced a 3:1 ratio where the dominant trait is present three times as compared to the recessive trait. Mendel used two terms to describe the relationship of the two phenotypes based on F1 and F2 phenotypes. The hereditary determinants are of specific nature. In 3:1 ratios , there are three progeny with the dominant phenotype for every one with the recessive phenotype

This implies that three offspring will have a dominant phenotype and there is one offspring that will have a recessive genotype, that is the recessive phenotype. Hence, the overall ratio of dominant to recessive phenotypes is 3:1.

To know more about Mendel's law, refer

brainly.com/question/843649

#SPJ4

You might be interested in
You are heating a substance in a test tube. Always point the open end of the tube
Leto [7]

Always point the open end of the tube away from all people because the chemical is dangerous for human health and skin.

If we heat a substance or chemical in a test tube, we should hold it away from people because may be it can explode and the chemical split on the body that cause serious problems in people. We have to handle laboratory procedures very carefully because the chemicals are not good for health and can cause serious diseases in humans and can damaged the skin very badly so we can conclude that the open end of the test tube should be placed away from the people.

brainly.com/question/24390373

4 0
3 years ago
Read 2 more answers
The next morning your team returns to work in the laboratory, where you get a call from the sheriff. The family of the three mis
azamat

Answer:

See below

Explanation:

1. Yes, the MNI ought to be changed in light of the revised inventory. Since 4 of the 6 femora are right sided, they would belong to different individuals, so the MNI would now be stated as 4.

2. The sheriff would be told that the possibility of suspecting 22 individuals is very narrow, though not impossible. It is also unlikely that the victims are numbered less than 4 in accordance to the bones found.

4 0
4 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Relation of acceleration of a body to its mass and applied force..​
vampirchik [111]

Answer:

The more mass a body has, more force needs to be applied for it to accelerate.

Explanation:

The relation of acceleration of a body to its mass and applied force is discussed in Newton's second law of motion.

Newton's second law of motion states that the more mass a body has, more force needs to be applied for it to accelerate.

7 0
4 years ago
Read 2 more answers
Which greenhouse gas is created by humans executively
TEA [102]

Answer:

Carbon dioxide

Explanation:

3 0
3 years ago
Other questions:
  • In cows black (B) is dominant to brown (b). If a brown purebred cow was mated with a black purebred cow what would the resulting
    11·1 answer
  • Which portion of the respiratory tract is commonly referred to as the "throat"?
    12·1 answer
  • What is the anatomy of the heart? What is the physiology of the heart?
    14·2 answers
  • Which of the following statements about DNA is true?
    15·1 answer
  • Peridotite, which is composed almost entirely of dark silicate minerals and is believed to make up much of Earth’s upper mantle,
    7·1 answer
  • The energy given off by burning fossil fuels can be measured in
    5·2 answers
  • Which of the following cell organelles helps to transport large extracellular molecules into the cell?
    14·1 answer
  • A drought is a period of unusually low
    8·1 answer
  • I need help, thank you!
    6·1 answer
  • A nurse is reviewing blood work for a child with a cyanotic heart defect. what result would most likely be seen in a client expe
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!